ID: 1064638966

View in Genome Browser
Species Human (GRCh38)
Location 10:17396399-17396421
Sequence GTGTAGCCATGGAGGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064638966_1064638973 18 Left 1064638966 10:17396399-17396421 CCCAGTTCCCTCCATGGCTACAC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1064638973 10:17396440-17396462 TATTGTCTTTGCCTATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064638966 Original CRISPR GTGTAGCCATGGAGGGAACT GGG (reversed) Intronic
900487660 1:2931119-2931141 GTGTAGGCCTGGAGGGACCTCGG + Intergenic
902157962 1:14505014-14505036 GTGTAGCTCAGGAGGGAACTAGG + Intergenic
903181925 1:21609122-21609144 GGGCAGCCATGAAGGGCACTGGG - Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
903848170 1:26290715-26290737 GTGGAGCCATGGAGGGAGGCAGG + Intronic
909265504 1:73553027-73553049 GTGTGACCATGGAGGAAGCTGGG - Intergenic
910058063 1:83055512-83055534 CTGGAGCCAGGGAGGAAACTTGG + Intergenic
911426219 1:97716612-97716634 GTGTGGTGATGGAGGGATCTAGG - Intronic
911817968 1:102378275-102378297 ATGTAAACATTGAGGGAACTTGG + Intergenic
912384582 1:109264942-109264964 GTATAGCCATGGGGGGCACTGGG - Exonic
914959230 1:152191454-152191476 GTGTAGGCATGAAGGGAAAGGGG - Intergenic
918017617 1:180651717-180651739 TTGTAGCCATGAAGTGATCTGGG + Intronic
920410320 1:205754297-205754319 GTGTAGCCCTTGATGGAAATGGG - Intergenic
920437861 1:205959823-205959845 GTGTAGCCACGGTGGGAGGTAGG - Intergenic
920845529 1:209590253-209590275 ATGCAGCCATGGAAGGAACATGG + Intronic
1062815800 10:499198-499220 GTGTAGCCATTGAGGGGTCAGGG - Intronic
1062883135 10:994940-994962 GTGAAGCCATGGAAGGGAGTAGG + Intronic
1064638966 10:17396399-17396421 GTGTAGCCATGGAGGGAACTGGG - Intronic
1069319606 10:67152160-67152182 GTGGAGGCAGGGAGTGAACTTGG + Intronic
1072001097 10:91196501-91196523 GTGAAGCCATGGAAAGATCTGGG - Intronic
1074826546 10:117219066-117219088 CTGTACCCATGGTGGAAACTAGG - Intergenic
1076171261 10:128322113-128322135 GTGTAGACTTGGAAGGACCTAGG + Intergenic
1077128701 11:958009-958031 GTGGAGCCACGGAGGCAACTCGG - Intronic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079398733 11:20088086-20088108 GTCTAGTCAGGGAAGGAACTAGG + Intronic
1080573310 11:33576697-33576719 GTGTAGCCAGGGAAGGAAGCGGG + Intronic
1083262925 11:61532870-61532892 GAGTGGCCAGGCAGGGAACTGGG - Intronic
1084409295 11:68997145-68997167 GTGAAGCCATGGAGGAAATGGGG + Intergenic
1088766444 11:112984529-112984551 GGGTAGCCATGTAGAGAAATGGG - Intronic
1089289876 11:117431133-117431155 GTCTGGCCATGGAGGGCACCAGG + Intronic
1096575547 12:52550503-52550525 GTGCAACCATGGAGGGTGCTGGG - Intronic
1097237570 12:57550405-57550427 GTGTCGCCCAGGAGGGAATTCGG + Intronic
1099835144 12:87900967-87900989 GGGTAGCCATGTTGGAAACTTGG - Intergenic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1100242370 12:92722354-92722376 TTGTAGCCATGCAGAGACCTAGG - Intronic
1101824616 12:108210386-108210408 GGGGAGCCATGGAGGGTACAGGG - Intronic
1103554350 12:121757104-121757126 GTGTGGCAAGGGAGGGAGCTCGG + Intronic
1104002123 12:124866426-124866448 GGGGAGCCATGGAAGGATCTAGG - Intronic
1104642517 12:130476513-130476535 GTGCAGCCAGGGAGGGAACAGGG - Intronic
1104731054 12:131105559-131105581 GTGTGGGCATGGAAGGAGCTGGG + Intronic
1105283385 13:18983384-18983406 GAGACGCCTTGGAGGGAACTTGG - Intergenic
1106968100 13:35098550-35098572 GTGTAGACATGGAATTAACTGGG + Intronic
1109571660 13:64200077-64200099 ATATAGCCATGGAGAGAACATGG + Intergenic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112148115 13:96724286-96724308 GTGGAGACAAGGAGTGAACTGGG + Intronic
1117023851 14:51599886-51599908 GTGTACCCATGGAGGCTCCTGGG + Intronic
1202834587 14_GL000009v2_random:68449-68471 ATTTAATCATGGAGGGAACTGGG + Intergenic
1123484807 15:20680943-20680965 GTGTAGACATGGAATTAACTGGG - Intergenic
1123537537 15:21250013-21250035 GTGTAGACATGGAATTAACTGGG - Intergenic
1126789600 15:52209071-52209093 GTCTAGCCTTTGAGGGAAATGGG + Intronic
1129702104 15:77774038-77774060 GTGCAGCCAAGGAGGGCAGTGGG - Intronic
1131865675 15:96706860-96706882 GTGCAGCTCTGGTGGGAACTGGG + Intergenic
1137641216 16:50031857-50031879 GTGTTGCCATGGAGGGAGGAAGG + Intronic
1139346617 16:66307870-66307892 GTGGAGCCATGGAAGGGTCTTGG + Intergenic
1140751862 16:78031906-78031928 GTTTAGACTTGGAGGGAAATGGG + Exonic
1141689786 16:85589463-85589485 GAGGAGCCATGGCGGGAACCTGG + Intergenic
1143031825 17:3972258-3972280 GTGTGGCCATGGGGAGAACAAGG - Intergenic
1143457837 17:7079157-7079179 TTGGAGCCATGGATGGAATTGGG + Intronic
1144743160 17:17595671-17595693 GGGTAGCCAGGGTGGGAACTGGG + Intergenic
1144794227 17:17880321-17880343 GTGTTACCATGTAGGGAGCTGGG - Intronic
1147164627 17:38586677-38586699 ATGGAGCCCTGGAGGGAGCTGGG + Intronic
1152536044 17:80950879-80950901 GTGGTGCCATGGAAGGAGCTGGG + Intronic
1152637938 17:81437827-81437849 GCCTGGCCATGGTGGGAACTCGG + Intronic
1152881041 17:82815445-82815467 GTGAAACCAGGGTGGGAACTGGG + Intronic
1156354788 18:36331786-36331808 GTGTGGCCATGCAGGGGAGTGGG + Intronic
1156817683 18:41330280-41330302 TTGTAGACCTGGAGGGAATTTGG - Intergenic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1160686456 19:439068-439090 GGGTGGCCATGGAGGGAGCTGGG + Intronic
1164306064 19:24004372-24004394 GTGTAGCCCTGGGAGGAACACGG + Intergenic
1164628128 19:29742979-29743001 GTGTTGGCATGAAGGAAACTTGG + Intergenic
1166620224 19:44290771-44290793 GGGAAGACATGCAGGGAACTGGG + Intronic
1167677873 19:50899508-50899530 GTTTAGCCAAGGAGGGTTCTTGG + Intergenic
1168694056 19:58395249-58395271 GTGTAGCCGGGGAGGTAACCAGG - Intergenic
925296469 2:2780550-2780572 GTGAAGCCTTGGAGGGTACAGGG - Intergenic
925675662 2:6358582-6358604 GTGTTGACAAGGAAGGAACTGGG - Intergenic
927653257 2:24924937-24924959 ATGCAGCCATGGAGGGGACTGGG - Intergenic
931283905 2:60816943-60816965 GTGTGGCCATGGAGAGATCAGGG - Intergenic
931926024 2:67073503-67073525 GGGGAGCCATGGAGGGAAAAAGG - Intergenic
934675753 2:96248637-96248659 GTGAAGCCATGGGGGCATCTGGG + Exonic
936599224 2:113879480-113879502 GTCTAGCAAATGAGGGAACTAGG - Intergenic
938633321 2:133193378-133193400 GTGTTGCCATGGGAGGAAATTGG + Intronic
940218929 2:151330801-151330823 GTGTTACCATTGAGGAAACTGGG - Intergenic
940627049 2:156188019-156188041 TTGTAGTCATCCAGGGAACTGGG - Intergenic
941314116 2:163970774-163970796 GTGTCCCCATGGAGATAACTTGG - Intergenic
942971885 2:181966919-181966941 GTGAAGCCATGGGGGGTGCTTGG + Intronic
943032110 2:182697744-182697766 GTCTAGGCTTGGAGGGAATTAGG + Intergenic
944924808 2:204453889-204453911 GTGTAGCCAGGGTGGGAACAGGG + Intergenic
944977019 2:205065546-205065568 GTGTAGCCGTGTTGGGAAGTGGG + Intronic
947276873 2:228401755-228401777 GAGCAGCCAGGCAGGGAACTTGG + Intergenic
1169074479 20:2752503-2752525 GTGGAGCCATTGAGGAAGCTGGG - Exonic
1171245630 20:23607780-23607802 GTGCAGCCAAGGAGGGGACAGGG + Intergenic
1175108124 20:56628761-56628783 CTGTGCCCACGGAGGGAACTGGG + Intergenic
1175798602 20:61787958-61787980 GTGTGGCCATGGGAGGGACTTGG + Intronic
1180855765 22:19043787-19043809 GTGTGGGCATGGAGTGTACTGGG - Intronic
1182354433 22:29716055-29716077 GTGAAGCTATGGAGGGACCTAGG - Intergenic
1182392818 22:30013415-30013437 GTGTGGTCATGGGGAGAACTCGG + Exonic
1182620755 22:31617195-31617217 GTCTAGCCATGGAGGGGTGTGGG + Intronic
1182873667 22:33671249-33671271 ATGTAGCCATTCTGGGAACTGGG - Intronic
1183022045 22:35035057-35035079 CAAGAGCCATGGAGGGAACTGGG + Intergenic
952433708 3:33250581-33250603 ATGTAGCTATGGACAGAACTAGG + Intergenic
954100216 3:48366723-48366745 ATGTAACCATTGAGGGAAATTGG + Intergenic
954270455 3:49503990-49504012 ATGTTACCATGGGGGGAACTGGG - Intronic
955157349 3:56429696-56429718 GTAGGGCCTTGGAGGGAACTGGG + Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
957760430 3:84548572-84548594 GTATGGCCAGGGAGGGACCTTGG + Intergenic
965666663 3:171101406-171101428 GTGTAGACCGGGAGGGGACTAGG - Intronic
966448084 3:180026000-180026022 GTGAAGCCATGGTTTGAACTTGG + Intronic
967475042 3:189906875-189906897 GTGCATCCTTGCAGGGAACTGGG + Intergenic
969218439 4:5742806-5742828 GTTTAGCCTGGGAGGGTACTTGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
974942858 4:68489743-68489765 GTGTAGCCAGGCAGGGAATTTGG + Intronic
977278192 4:95005563-95005585 GTGTAACCAGGAAGGGAAGTGGG - Intronic
979980576 4:127249505-127249527 TGGTAGCCATGGAGGGAAGGGGG + Intergenic
985525884 5:401433-401455 TTGTGGCCATGGAGGGACCATGG - Intronic
986366795 5:7040849-7040871 GTGTAGCCTTGGGGGAAATTGGG + Intergenic
987207498 5:15642640-15642662 GGGTTGCCATGGAGCAAACTAGG + Intronic
987259356 5:16187956-16187978 ATGTAGACATGGAGGGGACGTGG + Intergenic
988557644 5:32251478-32251500 CTGCAGTCATGTAGGGAACTGGG + Intronic
992076416 5:73196561-73196583 GTTTAGACATGAAGGGAGCTTGG - Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
998924727 5:147109689-147109711 TTGTTGCCATGGAGGGAACTGGG + Intergenic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999868825 5:155729147-155729169 GCTTAGAGATGGAGGGAACTGGG - Intergenic
1000276140 5:159736570-159736592 GTGTACCCATGGTGGGAAGCAGG - Intergenic
1001664865 5:173424189-173424211 GTGTTGGCATGAAGTGAACTTGG + Intergenic
1002374395 5:178777891-178777913 GTGGAGCCACGGTGGGAACAGGG + Intergenic
1003450163 6:6223362-6223384 TTGTAGGCATGGGGAGAACTTGG + Intronic
1006523812 6:34587598-34587620 GGGTGGCCATGGTGGGAAATGGG - Exonic
1007288904 6:40769395-40769417 GAGCAGCCAAGGAAGGAACTGGG - Intergenic
1009537532 6:64908296-64908318 GTGTTGCCTTGGCGGGAACATGG + Intronic
1010169443 6:72957630-72957652 GTGTAGACATGGAAGGAAACAGG - Intronic
1010678069 6:78767717-78767739 CTTTAGCCATGGCGGGAGCTGGG - Intergenic
1012143602 6:95653623-95653645 GTGTAGCCATGTTGGAAAATTGG + Intergenic
1014851762 6:126349247-126349269 ATGTAACCATTGGGGGAACTGGG - Intergenic
1029158566 7:98534781-98534803 GTGAAGCCATGGAAGGATTTTGG + Intergenic
1029380486 7:100211186-100211208 GTGAGGCCATGGAGGGAATCTGG + Intronic
1032793198 7:135257473-135257495 GTGTAGTCATGGTGTGATCTTGG + Intronic
1033289874 7:140074552-140074574 GAGAAGCCAGGGAGGGAACAGGG + Intergenic
1034531131 7:151697082-151697104 GTGTAGCCTGGGAGGGGCCTTGG + Intronic
1034998233 7:155591779-155591801 GTGTGGCTATGGAGAGAGCTTGG - Intergenic
1035421741 7:158735053-158735075 GTGCTGCCATGGAGGGCACATGG - Intronic
1037286311 8:17304335-17304357 TTGTAGCCATGGTATGAACTTGG - Intronic
1037678904 8:21076698-21076720 GTGCAGCCATGGAGAGCTCTGGG + Intergenic
1046577656 8:116051239-116051261 GAGTAACCATCGAGGGAATTAGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048856690 8:138692744-138692766 GTGTAGGCAAGGAGGAAGCTGGG - Intronic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1052252408 9:26414025-26414047 GTGTTGCCATTGAGGGTACTAGG + Intergenic
1055303071 9:74902395-74902417 GTGTAAGGATGGAGGGAACCCGG - Intergenic
1056709557 9:88979759-88979781 GTGTAACCATTGGAGGAACTGGG - Intergenic
1060689977 9:125649169-125649191 TTGTAGGTATGGAGGGGACTAGG - Intronic
1061595761 9:131628283-131628305 GTGTGGCCAGGGAGGGCCCTGGG + Intronic
1189172859 X:38926213-38926235 GTGGAGCTGTGGAGGCAACTGGG - Intergenic
1191795037 X:65012640-65012662 ATGTAGTCATGTAGAGAACTGGG - Intronic
1192435013 X:71137711-71137733 GTATAGCCCTGGAGGGAAGAAGG - Exonic
1193882151 X:86936479-86936501 GTGTAATCATGCAGGGACCTTGG + Intergenic
1194004936 X:88479071-88479093 ATGTATCCATGGAGGAAAATAGG - Intergenic
1199709559 X:150459523-150459545 GTGGAACCAGGGAGTGAACTTGG - Intronic
1200686212 Y:6262734-6262756 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200831884 Y:7693362-7693384 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1200989094 Y:9333650-9333672 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200991751 Y:9353980-9354002 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200994405 Y:9374260-9374282 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1200997068 Y:9394606-9394628 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200999584 Y:9463144-9463166 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201002242 Y:9483452-9483474 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1201004901 Y:9503739-9503761 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201007559 Y:9524066-9524088 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1201010190 Y:9544256-9544278 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202115011 Y:21464337-21464359 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202119242 Y:21507662-21507684 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202121694 Y:21531202-21531224 GTGTGTCCAGGGAGGGAACCTGG - Intronic
1202157311 Y:21898180-21898202 GTGTGTCCAGGGAGGGAACCTGG + Intronic
1202159758 Y:21921721-21921743 GTGTGTCCAGGGAGGGAACCTGG + Intergenic