ID: 1064638971

View in Genome Browser
Species Human (GRCh38)
Location 10:17396410-17396432
Sequence GTGGATGCCTAGTGTAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064638971_1064638973 7 Left 1064638971 10:17396410-17396432 CCATGGCTACACTAGGCATCCAC 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1064638973 10:17396440-17396462 TATTGTCTTTGCCTATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064638971 Original CRISPR GTGGATGCCTAGTGTAGCCA TGG (reversed) Intronic
903011503 1:20334048-20334070 GGGGCTGCCCAGTTTAGCCAGGG - Intronic
905594701 1:39196455-39196477 TTAGATGCCTAGTGTACTCATGG + Intronic
907890596 1:58632908-58632930 GATAATGCCTAGTGAAGCCATGG + Intergenic
908458809 1:64329711-64329733 GACAATGCCTAGTGAAGCCATGG + Intergenic
908511550 1:64853728-64853750 GTGGGTGCCTACTGTGGCCCAGG - Intronic
913099414 1:115549534-115549556 CTGGATACCTAGTATACCCATGG - Intergenic
914678675 1:149923649-149923671 GTGGAGGGCCAGTGTATCCATGG + Exonic
917648660 1:177053887-177053909 TTAGCTGCCTGGTGTAGCCACGG + Intronic
918856901 1:189767433-189767455 ATGAATGTCAAGTGTAGCCATGG + Intergenic
921619274 1:217308571-217308593 GGTAATGCCTAGTGGAGCCATGG + Intergenic
921755930 1:218855763-218855785 GTCAATGCCCAGTGAAGCCATGG + Intergenic
1064133352 10:12729824-12729846 GAGGGTGCCTGGTGTGGCCAAGG + Intronic
1064638971 10:17396410-17396432 GTGGATGCCTAGTGTAGCCATGG - Intronic
1070494018 10:77004979-77005001 GAGGATGCTTTGTGTGGCCAGGG - Intronic
1071171312 10:82868087-82868109 CTAGATCCCCAGTGTAGCCATGG + Intronic
1072510122 10:96113936-96113958 GTGGAAGCCCAGTGTAGAAAAGG + Intergenic
1073328230 10:102654880-102654902 GTGGATGCCCACTGGTGCCAGGG + Intronic
1074563471 10:114554905-114554927 GTGGTTGCCTAGTTTGCCCAGGG - Intronic
1076426782 10:130372665-130372687 GTGGATGCCTAGGGAGGCCACGG + Intergenic
1076981103 11:205259-205281 GTGGGTGCCAAGGGCAGCCAGGG - Exonic
1077052084 11:571518-571540 GTGGATGCCTGGGGGAGGCAGGG - Intergenic
1078357002 11:10639947-10639969 TTGAATGCCTATTGTGGCCAGGG + Intronic
1083099468 11:60288078-60288100 GGATATGCCTAGTGTAGCCATGG - Intronic
1089747774 11:120629081-120629103 TGGGAAGCCTGGTGTAGCCATGG + Intronic
1091341809 11:134821822-134821844 GTGGCTGCCTGCAGTAGCCACGG + Intergenic
1096516741 12:52160294-52160316 AGGAATGCCTAGTGGAGCCATGG - Intergenic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1099445023 12:82742078-82742100 GTGGAGGCCTAGTATGGCCCAGG + Intronic
1100107868 12:91199289-91199311 GTGGATACCTAGTTTTTCCAAGG + Intergenic
1104662216 12:130619633-130619655 GTGGATCTCTAATCTAGCCACGG + Intronic
1106598113 13:31164025-31164047 GTGGATGTGTTGTGTAGTCATGG + Intergenic
1109811635 13:67520366-67520388 GGCAATGCCTAGTGGAGCCATGG + Intergenic
1118571622 14:67200204-67200226 GTGGAGGGCCAGTGTATCCATGG - Intronic
1118906473 14:70027349-70027371 TTGGTTGCCTGGTGAAGCCAAGG + Intronic
1119560984 14:75589604-75589626 GGTAATGCCTAGTGGAGCCATGG - Intronic
1121627882 14:95399924-95399946 GTGGATGCCAAGTGAAGCTGTGG - Intergenic
1127738106 15:61866174-61866196 GTGGATGTCAAGTGTGGGCATGG - Intronic
1129130322 15:73487810-73487832 GGCAATGCCTAGTGAAGCCACGG - Intronic
1129274655 15:74437006-74437028 GTGAAGGCCATGTGTAGCCATGG - Intergenic
1132732610 16:1370276-1370298 GAGGATGGCGAGTGTAGCGATGG + Intronic
1134888644 16:17818605-17818627 GTGGTTTCCTGGTGTAGCCATGG - Intergenic
1137909552 16:52362719-52362741 GTTGATGGATAATGTAGCCATGG + Intergenic
1138474763 16:57264161-57264183 GTGGATCCCTACAGAAGCCAGGG + Intronic
1140682558 16:77399703-77399725 TTGAATGCTTAGTGTAACCAAGG - Intronic
1144195416 17:12890115-12890137 GGCAATGCCTAGTGGAGCCATGG - Intronic
1144758993 17:17696715-17696737 GAGGCTGCCTAGTGTGGACAGGG + Intronic
1146548519 17:33759931-33759953 GGTAATGCCTAGTGGAGCCATGG + Intronic
1156386180 18:36607101-36607123 GGCAATGCCTAGTGGAGCCACGG - Intronic
1164514396 19:28921737-28921759 GGTAATGCCTAGTGGAGCCATGG + Intergenic
925696307 2:6583515-6583537 GTGGATCCCAAGTGCACCCACGG - Intergenic
925807411 2:7664535-7664557 GAGGATGCCCAGTGTTGCCCAGG + Intergenic
927056900 2:19373661-19373683 GTCAATGCTTAGTGAAGCCATGG - Intergenic
931509592 2:62976250-62976272 GTGGATGTCCAATGGAGCCAGGG - Intronic
932238986 2:70142532-70142554 GCCGATGCCTAGTCTAGCCAGGG - Intergenic
935658027 2:105441526-105441548 GTGGATACCTTGTATATCCATGG + Intergenic
937937312 2:127256560-127256582 TTGGAAGCCTTATGTAGCCAGGG + Intergenic
940372450 2:152918297-152918319 GGCAATGCCTAGTGGAGCCATGG + Intergenic
942321260 2:174738127-174738149 GTGAATGCCTAATGTGGCCTTGG + Intergenic
945143722 2:206714698-206714720 ATGGCTGCATGGTGTAGCCAGGG + Intronic
1172488803 20:35317529-35317551 ATGGATGGCTAATGTAGCCCTGG - Intronic
1177946712 21:27479595-27479617 GTCAATGCTTAGTGGAGCCATGG - Intergenic
1178933253 21:36838083-36838105 TTGGTTGACTAGTGTAACCAAGG + Intronic
1185051196 22:48555170-48555192 GTGGATGCCGAGTGAAGGGAGGG + Intronic
950414477 3:12860899-12860921 GTGGCTGCCTGATGTGGCCATGG - Intronic
956397430 3:68840839-68840861 GTGGTTGGTTAGTCTAGCCATGG - Intronic
958419446 3:93914202-93914224 GGCAATGCCTAGTGGAGCCATGG - Intronic
958492458 3:94794803-94794825 GTTGCTGACTAGTGTAGACAAGG - Intergenic
961155451 3:124675925-124675947 GTGGTTACCTAGTGAGGCCAGGG - Intronic
961313683 3:126019880-126019902 GACAATGCCTAGTGGAGCCATGG - Intronic
961450436 3:127000018-127000040 GTGGGGGCCTGGTGCAGCCAAGG + Intronic
966216455 3:177508142-177508164 GGTAATGCCTAGTGGAGCCATGG + Intergenic
967080819 3:186048019-186048041 GTGGTTCCCAAGAGTAGCCATGG + Exonic
969487628 4:7481124-7481146 GAGGATGCCATGTGTGGCCAAGG - Intronic
974504405 4:62749580-62749602 ATGAATGACTAGTGAAGCCAGGG + Intergenic
974677456 4:65111896-65111918 CTGGATGCTTATTGTAGACAAGG + Intergenic
975539540 4:75492449-75492471 GTGGAGGCCTAGAGAAGCTAAGG + Intronic
975719891 4:77239216-77239238 GTAAATGCATATTGTAGCCACGG - Intronic
977877494 4:102166140-102166162 GTTAATGCCTAGTGGAGCCATGG + Intergenic
977904001 4:102455211-102455233 GGCAATGCCTAGTGGAGCCATGG - Intergenic
981688653 4:147481817-147481839 GGGTATGCCAAGGGTAGCCAAGG + Intronic
983459810 4:168014243-168014265 GTGGATGCCTGGTTTTCCCAAGG + Intergenic
984304089 4:177964660-177964682 GAGCATGTCTAGTGTAGCTAAGG - Intronic
985192210 4:187387306-187387328 GTGGCTGCCTAGGGAGGCCAGGG + Intergenic
986835167 5:11629077-11629099 GTGGATCCCTAGAGTAGGAAAGG - Intronic
987830279 5:23086670-23086692 GTGGAAGCATGGTTTAGCCATGG - Intergenic
989340452 5:40368342-40368364 GATAATGCCTAGTGCAGCCATGG - Intergenic
991180087 5:63740443-63740465 CAGGATACCTAGTGAAGCCATGG + Intergenic
997713984 5:136028839-136028861 GTGGGTGCCCAGGGCAGCCAGGG + Intergenic
998651688 5:144127738-144127760 TTGGCTGCCCAGTGTAGGCATGG + Intergenic
999499453 5:152132230-152132252 GTCAATGCTTAGTGGAGCCATGG - Intergenic
1003003114 6:2355500-2355522 ATGGAGGCCCTGTGTAGCCAAGG + Intergenic
1006752191 6:36385607-36385629 GTGGGTGCCTAGGGGAGGCATGG + Exonic
1006874181 6:37280958-37280980 TGGGATGCCTAGTGTAACGAGGG - Intronic
1007220153 6:40272517-40272539 GTCAATGCCTAGTGAAGCCATGG - Intergenic
1008504869 6:52219935-52219957 GATAATGCCTAGTGAAGCCATGG + Intergenic
1010653213 6:78479545-78479567 GAGAATGCCTAGTGGAGCTATGG - Intergenic
1010960882 6:82144437-82144459 GTGAATGGCTAGTGTACTCAGGG + Intergenic
1018855365 6:167670589-167670611 GTGGATGCCTCCTGTGTCCAGGG - Intergenic
1019725928 7:2602681-2602703 GTGGATGAGTAATGTGGCCAAGG - Intronic
1020719237 7:11720699-11720721 GTAGATGTCTATAGTAGCCATGG - Intronic
1022553928 7:31272514-31272536 ATGTAAGCCTAGGGTAGCCAGGG - Intergenic
1022667803 7:32428164-32428186 GTGGATTCCTCGGGGAGCCAGGG - Intergenic
1025162593 7:56676138-56676160 GTGGCTGCCTAGAGTGGCAAAGG - Intergenic
1026658561 7:72278558-72278580 GTTGTGGCCAAGTGTAGCCATGG - Intronic
1027183822 7:75957817-75957839 CTGGATGCCTGCTGCAGCCAGGG + Intronic
1028773161 7:94650326-94650348 GTGGATGCCGAGGGTACCTAGGG - Intronic
1030121903 7:106118359-106118381 GTGGGTGCTTGGTGTAGCCATGG + Intergenic
1032746748 7:134793733-134793755 GTGGATGCTTATTCTATCCATGG + Intronic
1033616680 7:143023209-143023231 GGGGATGCCTAGTGAAGCCATGG + Intergenic
1035025935 7:155825843-155825865 GTGGAAGCCAAGTGAAGGCAGGG - Intergenic
1035063788 7:156090916-156090938 CTGTTTGCCTAGTGGAGCCAAGG - Intergenic
1035887787 8:3310464-3310486 GTGGACTCCAAGTGTGGCCAGGG - Intronic
1037961932 8:23104163-23104185 ATGGATGACCAGTGTAGACAAGG + Intronic
1038685867 8:29717941-29717963 GTGGAGGACTCTTGTAGCCAAGG + Intergenic
1039651147 8:39340487-39340509 GGAAATGCCTAGTGAAGCCATGG - Intergenic
1046623721 8:116555671-116555693 GTGGATGCCCAGGGTAGGGAAGG + Intergenic
1047108348 8:121760160-121760182 GTGGAACCCTAGTCTAGCTAAGG + Intergenic
1049801403 8:144519188-144519210 GTGGAGTCCAAGTGTAGCCCTGG + Intronic
1050737301 9:8778759-8778781 GTGGATGAATATTGTAGCCACGG - Intronic
1056386710 9:86102726-86102748 GGAAATGCCTAGTGGAGCCATGG - Intergenic
1058528230 9:105881260-105881282 ATGACTGCCTAGTCTAGCCATGG + Intergenic
1061482074 9:130902314-130902336 GTGGCAGCCTAGTGTGGCCGGGG - Intergenic
1186815560 X:13234459-13234481 ATGGATGTGTAGTGTAGTCAGGG + Intergenic
1186823781 X:13317283-13317305 GTGGATGCCTACAGAAGCCCAGG - Intergenic
1186855124 X:13618941-13618963 GTAGATGCTTAGTTTACCCAAGG + Intronic
1188128405 X:26399664-26399686 GGCAATGCCTAGTGCAGCCATGG + Intergenic
1192321110 X:70091552-70091574 GTGGAGGCCCAGACTAGCCAGGG + Intergenic
1192565337 X:72158648-72158670 GGCAATGCCTAGTGGAGCCATGG - Intergenic
1195805765 X:108763511-108763533 GGCGATGCCTAATGGAGCCATGG - Intergenic
1197599286 X:128508453-128508475 GGCAATGCCTAGTGGAGCCATGG + Intergenic