ID: 1064642133

View in Genome Browser
Species Human (GRCh38)
Location 10:17425932-17425954
Sequence CTGTGGAAAAAGAGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 550}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064642133_1064642146 27 Left 1064642133 10:17425932-17425954 CCATCCCCACTCTTTTTCCACAG 0: 1
1: 0
2: 5
3: 50
4: 550
Right 1064642146 10:17425982-17426004 CTTATCACAGGAACCAGTCACGG No data
1064642133_1064642142 15 Left 1064642133 10:17425932-17425954 CCATCCCCACTCTTTTTCCACAG 0: 1
1: 0
2: 5
3: 50
4: 550
Right 1064642142 10:17425970-17425992 CAAGCCATCCTCCTTATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064642133 Original CRISPR CTGTGGAAAAAGAGTGGGGA TGG (reversed) Intronic
900518426 1:3094259-3094281 CTGTGGAGGCAGGGTGGGGATGG - Intronic
901798347 1:11692937-11692959 CTGTGGAGGAAGGGAGGGGAGGG + Intronic
902776172 1:18676388-18676410 CTGGGGAGAGAGGGTGGGGAGGG + Intronic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
902778149 1:18687718-18687740 CTCTGGACACTGAGTGGGGAGGG - Intronic
903025637 1:20428218-20428240 TTGTGGAAAGAGAGTGGGAGAGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903606328 1:24577657-24577679 CTGAGAAAAAAAATTGGGGATGG - Intronic
903840183 1:26233626-26233648 CTGTGGACCAAGTTTGGGGAGGG + Intergenic
904076891 1:27850087-27850109 CTGTAGAAGAAGCGTGTGGAGGG + Exonic
904458971 1:30664176-30664198 ATGTGGAAAGGGAGTGGGGGAGG + Intergenic
904896460 1:33821774-33821796 CTGTGGGACCACAGTGGGGAGGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
907872670 1:58457101-58457123 CTGTGCAAAATGAGAGGAGATGG - Intronic
909259961 1:73474776-73474798 CTTGGGAAACAGAGTGGGCAAGG + Intergenic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
909963811 1:81881965-81881987 CTCAGGAAAAAAAGGGGGGATGG - Intronic
911551534 1:99287695-99287717 GTGTGGAAAATGAATGGGTATGG + Intronic
911934770 1:103955540-103955562 ATGTTGAAAAACAGTGGTGAGGG + Intergenic
913472617 1:119204453-119204475 CTGTGGGAATAGAGTAGGGTTGG - Intergenic
914242880 1:145863931-145863953 TTGAGAAAAAAGAGTGGGGAGGG - Intergenic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916888891 1:169097446-169097468 CAGTGGAGAAACAGTGAGGAGGG + Intergenic
916889910 1:169105367-169105389 CAGCGGACAAAGAGTGGGAAGGG + Intergenic
917250723 1:173057675-173057697 TTGTGGACAAAAAGTGGGTAAGG + Intergenic
917521934 1:175754885-175754907 ATTTGGAAAAAGGGTAGGGAGGG + Intergenic
918159741 1:181887141-181887163 ATGTTGAAAAGGAGTGGGGAGGG + Intergenic
919190400 1:194209519-194209541 TTGAGGGAAAAGAGTGGGAAGGG + Intergenic
919270224 1:195332076-195332098 CAGTGAAGTAAGAGTGGGGAAGG + Intergenic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
920084044 1:203401492-203401514 CTGTGTATAGAGAGTGCGGAAGG + Intergenic
920140621 1:203809470-203809492 CTATGAAAAAAGAGTGGGGCTGG - Intronic
920381867 1:205539412-205539434 CTGTAGAAGATGAGTGGGGGTGG + Intergenic
920518179 1:206602207-206602229 CTGTGGAAAGAGTGGAGGGAAGG - Intronic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
922095480 1:222439641-222439663 ATGTGGAAAGAGAGTGGGGGTGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922680447 1:227590872-227590894 CTGTATAGCAAGAGTGGGGAAGG - Intronic
922690413 1:227684740-227684762 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
923023102 1:230181131-230181153 GTGTTGAAGAAGAGTGGTGAGGG + Intronic
923434873 1:233958353-233958375 CTAAGGAAAAAGAGTGAGAAAGG - Intronic
924556369 1:245122458-245122480 CTCCAGAAAAAAAGTGGGGAGGG - Intronic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
924832328 1:247610207-247610229 ATGTTGAATAACAGTGGGGAAGG - Intergenic
1063975020 10:11408160-11408182 CTGTGCACACAGAGTGGGGCAGG + Intergenic
1064412325 10:15117501-15117523 TTGTTGAGAAAGAGTGGGGAAGG - Intronic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1064720823 10:18226918-18226940 ATATGGAAAAAAAGTGGGGGAGG + Intronic
1066509753 10:36083257-36083279 CTGTAGAACATGGGTGGGGATGG + Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1068002831 10:51356567-51356589 CAGAGGAAAAAGAGTAGGGGAGG - Intronic
1068950242 10:62769640-62769662 CTCTGGAAATATGGTGGGGAGGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070913783 10:80139672-80139694 CTCTCAAAAAAAAGTGGGGAGGG + Intronic
1072044125 10:91637671-91637693 GTGAGGAAAAGGAGAGGGGAGGG + Intergenic
1072310318 10:94148200-94148222 CTGTCCAAAAAAAGTGGAGATGG + Intronic
1072392690 10:95004313-95004335 CTTGGGAGAAAGAGTGGGAAGGG - Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073974409 10:109085182-109085204 CTCTGGAAAAAAAGGGGTGAAGG - Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074758839 10:116649068-116649090 TTGAGGGAGAAGAGTGGGGAGGG - Intergenic
1075508131 10:123044238-123044260 CTGTGGAAAAACAGCGTAGAGGG + Intronic
1075586865 10:123664974-123664996 CTGTGGGGAAGGGGTGGGGATGG - Intergenic
1076138148 10:128058839-128058861 CTCTGGTAAAAGACTGGGAAAGG - Intronic
1076291460 10:129349124-129349146 CTGTGGCCCAACAGTGGGGAAGG - Intergenic
1076639715 10:131906205-131906227 CTATGGAGAAACCGTGGGGAGGG + Intronic
1077239496 11:1503127-1503149 CTGTGGAGAAGGGATGGGGAGGG + Intergenic
1077479332 11:2806284-2806306 GTGAGGAAGAAGAGAGGGGAGGG + Intronic
1077697465 11:4407271-4407293 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1078551908 11:12287064-12287086 CTGTGGAAAAAGAAAGGGACAGG - Exonic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1079426440 11:20346752-20346774 ATGTTGAAAAGGAGTGGTGAGGG - Intergenic
1079501254 11:21103829-21103851 CCGTTGAAAGAGACTGGGGAAGG - Intronic
1079539028 11:21549917-21549939 GAGTGGAAAAAGAGTGAGGCAGG + Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1080357301 11:31464898-31464920 ATGTTGAATAAGAGTGGTGAAGG - Intronic
1080382102 11:31782662-31782684 CTGCAGAAAAACAGTTGGGATGG + Intronic
1081090603 11:38861527-38861549 CTTGGGAAAAAGGGTGGGAAGGG - Intergenic
1081318511 11:41661140-41661162 CTGTGAAGAAACAGTGTGGATGG - Intergenic
1081412435 11:42775865-42775887 CCCTGGAAATAGAGTGGGCATGG - Intergenic
1081566366 11:44263543-44263565 CTGTGGAAGAAGTGTAAGGACGG + Exonic
1082728891 11:56771055-56771077 CTCTGGGGAAAGAGTGGGAAGGG - Intergenic
1083090201 11:60191695-60191717 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1084495613 11:69501451-69501473 GAGAGGAAAAGGAGTGGGGAGGG + Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085005133 11:73081040-73081062 TTGTGGAAAAAGACTGGGATTGG + Intronic
1085340177 11:75726206-75726228 CTGGGGAAAGAGAGTGGCCAAGG + Intronic
1085529582 11:77183508-77183530 CTGTGGAACAAGAGTGCTCATGG + Intronic
1085813171 11:79704992-79705014 CTAAGTAAAAAGAGTAGGGAGGG + Intergenic
1086906463 11:92423673-92423695 CTGTAGAGAGAGGGTGGGGAGGG + Intronic
1087232852 11:95685378-95685400 CTGTTGAGAAAGTGAGGGGAGGG + Intergenic
1087684836 11:101250807-101250829 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1088358263 11:108965789-108965811 ATGTGGAAAGAGAGTATGGAGGG + Intergenic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089625279 11:119747217-119747239 CTTTGAAAATGGAGTGGGGAGGG - Intergenic
1089737589 11:120560847-120560869 CAGTGGAAGAGCAGTGGGGATGG + Intronic
1089761727 11:120731098-120731120 ATGTTGAATAAAAGTGGGGATGG + Intronic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1091418562 12:313995-314017 GGGTGGAAAAAGAGTGGGGCAGG + Intronic
1092060802 12:5548864-5548886 CTGTGGAGTGAGAGTGAGGAAGG - Intronic
1092525105 12:9305082-9305104 CTGTGGGAGAAGCGCGGGGACGG - Intergenic
1092542161 12:9426736-9426758 CTGTGGGAGAAGCGCGGGGACGG + Intergenic
1092748475 12:11695715-11695737 CACTGGAGAAAGAGTGGAGAAGG - Intronic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093376084 12:18429590-18429612 CTGTGGACTAAGAGGGGGAAGGG - Intronic
1093506465 12:19872237-19872259 GTGGGGAAAAAGGGTGGGAAGGG + Intergenic
1094052718 12:26238696-26238718 CTGTGGAATAAGGTTGGGGGAGG - Intronic
1095485607 12:42681257-42681279 CTGAGGAACAGGACTGGGGAAGG - Intergenic
1096273821 12:50188739-50188761 CCGTGGAACTTGAGTGGGGAGGG + Intronic
1096836342 12:54353578-54353600 TTGTGGGAAAAGAGGGGGCATGG - Intergenic
1097152712 12:56991385-56991407 TTGGGGAAAAAAAGTGGGGCGGG + Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1098248711 12:68546469-68546491 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1098263502 12:68695681-68695703 CTGTGGATACATAGTGGTGATGG + Intronic
1101413023 12:104484881-104484903 TTGTTGGAAAAGAGTGGGAAGGG + Intronic
1101688787 12:107053993-107054015 CTATAGAAAAAGACTGGTGATGG - Intronic
1101977889 12:109377894-109377916 CTATGGGAAACAAGTGGGGAAGG - Intronic
1102505672 12:113383263-113383285 CTGTGGGAAAGGGGTGGGAATGG + Intronic
1102821169 12:115910350-115910372 CTGTGGAAAAAGAGCCTGGCTGG - Intergenic
1103171087 12:118820588-118820610 CCAAGGAAAAAGAGTGGGCATGG + Intergenic
1103615489 12:122149116-122149138 CTGAAGGAAAAGAGTGGAGATGG - Intergenic
1103846289 12:123903875-123903897 TTCTGGATGAAGAGTGGGGAAGG - Intronic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104632034 12:130411386-130411408 ATGTGGAAAAGGAGTGGTGAGGG + Intronic
1104891617 12:132142940-132142962 CGGTGGAAAAAGCTAGGGGAGGG + Intronic
1106295995 13:28414104-28414126 CTGTGGAAGAAGTGTGGTCAGGG + Intronic
1106574236 13:30959268-30959290 ATGAGGAATAAGAGTAGGGATGG - Intronic
1106699051 13:32209217-32209239 CTGGGGATAAATAGTGGTGATGG + Intronic
1106767866 13:32933372-32933394 CTGAGGAAGAGGTGTGGGGAAGG + Intergenic
1106939769 13:34764996-34765018 GTGGGGAAAACAAGTGGGGAGGG + Intergenic
1107331711 13:39308435-39308457 CACTGGAGAAAGAGTTGGGAAGG - Intergenic
1108186116 13:47890063-47890085 CAGTGGAAAATGAGTGGAGGGGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108801435 13:54100978-54101000 ATGAGGAAAAAAAGGGGGGAAGG - Intergenic
1111657776 13:91174834-91174856 CTTTGGAAAGACACTGGGGATGG - Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1112580287 13:100672493-100672515 CTGTTCAAAAAAAGGGGGGAAGG - Intronic
1112709146 13:102106569-102106591 CTGTCGAAAAAGAGGGAGGGAGG + Intronic
1113425024 13:110200546-110200568 CCGTGGGAAAAGAGGGGGGCAGG + Intronic
1114573905 14:23695317-23695339 ATCTGGAAAAAGAGGGGGGAGGG + Intergenic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1116239686 14:42324771-42324793 CAGAGGAAAAGGACTGGGGATGG + Intergenic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1116969697 14:51051431-51051453 CTGTGGAAAAAGGGTGGAAGAGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1118991410 14:70800395-70800417 ATGTGGAAAAATAGTAGGGAAGG + Intronic
1119348092 14:73942716-73942738 CTGTGGAGAAAGGATGGTGATGG + Intronic
1119620203 14:76126133-76126155 CTGAGGAAAACTATTGGGGAAGG + Intergenic
1119640003 14:76307841-76307863 CTGGGGAAAAAGAATGGAGCAGG + Intergenic
1119950406 14:78738675-78738697 GTGGGGAAAAAGAATGGGGTGGG - Intronic
1120068285 14:80072054-80072076 CTTTGGAGAAAGAGGGGCGATGG - Intergenic
1120181087 14:81342866-81342888 CAGAGGAAAAAGAGTGGTGGTGG + Intronic
1120754888 14:88233502-88233524 CTGGGGACAAAGCATGGGGAAGG + Intronic
1121299644 14:92860358-92860380 CGGCGGAAAAGGAGAGGGGAAGG + Intergenic
1121547143 14:94770576-94770598 CTGAGAAAAAAGGGTGGGGGTGG - Intergenic
1121667637 14:95685262-95685284 CCTTGGAAAAACACTGGGGATGG + Intergenic
1122237445 14:100339940-100339962 CCGTGGGAAAAGCCTGGGGAGGG - Intronic
1122825965 14:104370605-104370627 CTGTGGAAAGAGCGTGAAGACGG - Intergenic
1125675208 15:41498526-41498548 CTGTGCAGAAACAGTGAGGAGGG - Intronic
1125993207 15:44130363-44130385 CTTTGGAAAAAGAGTTGGAAAGG - Intronic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1126688624 15:51269811-51269833 CTGTGAAAGAAGAGAGGGAAGGG - Intronic
1126867745 15:52954702-52954724 CTCTGGAAAGAGACTGGGGAAGG - Intergenic
1127131201 15:55865755-55865777 CTCAGGGAAAAGAGTTGGGAAGG + Intronic
1128675220 15:69603413-69603435 GTGTGGAGAAAGAGGAGGGAGGG + Intergenic
1129068728 15:72933226-72933248 CTATGGAATGGGAGTGGGGAGGG + Intergenic
1129168631 15:73794238-73794260 CTGTGGAAAGGGAGTGGTCATGG + Intergenic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129571772 15:76693895-76693917 CTGTGGATTAACAGTGGTGATGG + Intronic
1129915997 15:79272421-79272443 TTGGGGAAAAACAGCGGGGAGGG + Intergenic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1132349560 15:101131093-101131115 CTGTGGATGAATAGTGGTGATGG + Intergenic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1133065940 16:3207153-3207175 CTGTCAAAAAAGGGAGGGGAGGG + Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1135069381 16:19338802-19338824 TTGTGGCATAAGTGTGGGGAAGG - Intergenic
1135471860 16:22738180-22738202 CTGTGGATACAGAGAGGGGCTGG + Intergenic
1135617389 16:23923523-23923545 ATGTGGACCAAGAGTGGGAAAGG + Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1136403850 16:30032022-30032044 CTGAGGAAAAAGTGAGGGGTGGG - Intronic
1136730863 16:32411131-32411153 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1136899785 16:34022762-34022784 ATGTTGAAAAGGAGTGGTGAGGG - Intergenic
1137455791 16:48616849-48616871 CTGGGGAAAAAGCGTGGAGGAGG + Intronic
1137489312 16:48918418-48918440 CTGTGAAAACAGAGTTGGGAGGG - Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137705899 16:50535710-50535732 CTGTGGAACACGTGTGGTGACGG - Intergenic
1138446647 16:57068459-57068481 ATGTGGAAAAAGATTGGCAAAGG - Intronic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1139265929 16:65638229-65638251 GTGTGGAAAAAGCACGGGGAAGG + Intergenic
1139472384 16:67185108-67185130 TTGGGGGAAAAGATTGGGGAAGG - Intronic
1140780569 16:78292957-78292979 CTGTTCAACAAGGGTGGGGAGGG - Intronic
1140816428 16:78625243-78625265 CTGAGGCTAAAGAGTGGGGCTGG - Intronic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141285031 16:82663483-82663505 CTGTGTAAAATGAGTGGCGGTGG - Intronic
1141324307 16:83040978-83041000 CTGAGGAATAAGAGTGGTGATGG - Intronic
1202995534 16_KI270728v1_random:106138-106160 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1203022221 16_KI270728v1_random:418480-418502 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1143619094 17:8070960-8070982 CTAAGGAAGAAGAGTGGGCAGGG + Intergenic
1144698211 17:17320242-17320264 CTGTTTAAAAAGAGTGGGTCTGG + Intronic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1146456793 17:33015047-33015069 CTGTGGAACGGAAGTGGGGAAGG - Intronic
1146459963 17:33038579-33038601 CAGTGGAGAAAGAGTGGGGGAGG - Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146764477 17:35506865-35506887 CTGTATAGCAAGAGTGGGGAAGG + Intronic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1146936863 17:36817468-36817490 CTGTGTGAAAAGTGTGGGTATGG - Intergenic
1147302294 17:39539594-39539616 CTGAGGAAGAAGACTGGGGGAGG + Intronic
1148197130 17:45722135-45722157 CTGTGGGAAAAGACTTTGGAGGG - Intergenic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1150378326 17:64700713-64700735 CTGTGAAAACAGAGTAGGGATGG + Intergenic
1151045180 17:70911588-70911610 CTGTGGATGAAGAGTGGTCATGG + Intergenic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151741186 17:75983370-75983392 CTGGGGAAAAAGAGGTGGGGAGG - Intronic
1151998187 17:77625399-77625421 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1152168856 17:78729889-78729911 CTGTGGAAAGAGAGTGGGGGAGG + Intronic
1152248513 17:79199152-79199174 CTGTGGTCATAGGGTGGGGATGG + Intronic
1152993379 18:383663-383685 GTGTGGAGAAGGAGTGGGTAGGG - Intronic
1152997970 18:425836-425858 CTGTGGAACAAGAGATGGGGTGG - Intronic
1154215341 18:12411762-12411784 CAGTGGAACACCAGTGGGGAGGG - Intronic
1155614756 18:27708708-27708730 CTGTGGTTTAAGAGTGTGGATGG + Intergenic
1157174735 18:45441112-45441134 AAGTGGAAAAAGAGAGGGCATGG - Intronic
1158179918 18:54702765-54702787 TTGTGTAAAAAGAGTGTTGATGG + Intergenic
1159269357 18:66129046-66129068 CTGGGGAAATTGGGTGGGGAGGG + Intergenic
1159837741 18:73359848-73359870 TTTTGGAAATAGAGTGGTGATGG - Intergenic
1159935843 18:74366978-74367000 CTGAGGACAAAGAGTGGTGAAGG + Intergenic
1161228910 19:3162770-3162792 CTGGGGAAACAGTGTGGGAAGGG - Intronic
1161412106 19:4122818-4122840 CTGTGGGAAAAGACAGGGCATGG - Intronic
1161639990 19:5416181-5416203 CTGTGGAAAAAGAGTGTGGCAGG - Intergenic
1161777834 19:6273380-6273402 GTGTGGGAAGAAAGTGGGGATGG + Intronic
1161927598 19:7312846-7312868 TTGTGGAAAGTGAGTGGGGATGG - Intergenic
1164126713 19:22325040-22325062 ATATATAAAAAGAGTGGGGAGGG - Intergenic
1164400902 19:27901546-27901568 GTGTGGAAAAAGAATGGAAAGGG + Intergenic
1164861499 19:31565542-31565564 ATTGGGAAAAAGAGTGTGGATGG + Intergenic
1164868152 19:31622148-31622170 CATTGGAAAGAGAGAGGGGATGG + Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165459993 19:35938751-35938773 CAGTGGACAAAGAGAAGGGAGGG - Intronic
1165466349 19:35977272-35977294 GTCTGGACAATGAGTGGGGAGGG - Intergenic
1165700379 19:37932838-37932860 CTGTGAAGAAAGAGTGGGCCGGG + Intronic
1166901518 19:46067583-46067605 CTGTGGGAAACGAATGGGGTCGG - Intronic
1167201193 19:48066660-48066682 TTGTAACAAAAGAGTGGGGAAGG + Intronic
1167521038 19:49955270-49955292 ATCTGGAAAAAGAGCGGGGCGGG + Intronic
925864293 2:8212705-8212727 ATTTATAAAAAGAGTGGGGAAGG - Intergenic
926308499 2:11657642-11657664 CAGTGGCAAAAGACAGGGGAGGG - Intergenic
927615195 2:24586918-24586940 CTGGGGCAAAACAGTGGGGGAGG - Intronic
928324330 2:30307683-30307705 TTGTGGAAAGAGACTGGGAATGG + Intronic
928868201 2:35943975-35943997 TTGTTGAAAAAAAGTGGGGATGG + Intergenic
929441030 2:41965907-41965929 CAGAGGAGAGAGAGTGGGGATGG + Intergenic
929945292 2:46366808-46366830 CTGGGGGAAATGAGCGGGGAAGG + Intronic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
930975529 2:57454950-57454972 CTGTGTATAAAGAATGGGGGTGG - Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931898483 2:66761157-66761179 CTTTGGAGAAAGTTTGGGGATGG + Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932443514 2:71755321-71755343 CTGTGGAGAAAAAATTGGGAAGG - Intergenic
932498673 2:72160787-72160809 CTGAGGATCAAGAGTGGGGCTGG - Intergenic
933174319 2:79158773-79158795 AGGTGGAAGAAGAGGGGGGAGGG + Intronic
933209091 2:79545298-79545320 CTATGGACAGGGAGTGGGGAAGG - Intronic
933904447 2:86876382-86876404 CTGTACAAAAAGAGTGGGTGTGG + Intergenic
935528361 2:104200829-104200851 CTGAGGAAAAAGAGAAGAGAAGG + Intergenic
935721169 2:105980578-105980600 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
935828741 2:106977195-106977217 CTGTGGCATCAGAGTGTGGATGG + Intergenic
936412442 2:112272623-112272645 GTGTGGATAGAGGGTGGGGAAGG + Intergenic
936509063 2:113131022-113131044 CTGGGGAAGAACAGAGGGGAGGG - Intronic
936651605 2:114433567-114433589 CTATGGGCATAGAGTGGGGAGGG + Intergenic
936751761 2:115650813-115650835 GAGCGGAAAAGGAGTGGGGAGGG + Intronic
936894860 2:117415808-117415830 ATGTTGAATAAAAGTGGGGAGGG + Intergenic
937483004 2:122282140-122282162 CTGTGCACAAAAAGTGAGGAGGG - Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940488246 2:154324099-154324121 GTGTGGGAAAAGAGTGGAGTAGG - Intronic
942262389 2:174181834-174181856 CTGAGGAGAAAAAGTAGGGAAGG - Intronic
943238951 2:185360206-185360228 CTGTCAAAAAAAAGGGGGGAGGG + Intergenic
945151042 2:206792289-206792311 CTGTTGAAAATGAGTGAGGATGG + Exonic
945357067 2:208853194-208853216 CTGTGGTACAAGAGTGTGGTTGG + Intronic
945359158 2:208875722-208875744 CTGTTGAATAAGACTGGTGAGGG + Intergenic
945401046 2:209383097-209383119 CAGGGGAAAAAGGGTAGGGAGGG - Intergenic
945698578 2:213141300-213141322 GTGGGGAAAAAGATTGTGGATGG - Intronic
947315829 2:228856936-228856958 CTGTAAAACAAGAGTGGGAAGGG + Intronic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
947858033 2:233337689-233337711 CTCTGGAAAAAGAGTTGGGGCGG - Intronic
948271797 2:236679829-236679851 CTGTGGTCAAAGAATGTGGATGG - Intergenic
948570576 2:238914819-238914841 CTGCCGAAAGAAAGTGGGGAGGG + Intergenic
948726055 2:239934828-239934850 GTGTGGAAAACGGGTGGGGGCGG - Intronic
1169023333 20:2347249-2347271 GAGTGGAAGAGGAGTGGGGAAGG - Intergenic
1169210692 20:3764845-3764867 GTGAGGCAAAAGAGTGGGGTGGG - Intronic
1170830973 20:19840269-19840291 CCAGGGAAAAGGAGTGGGGAAGG - Intergenic
1170986842 20:21266552-21266574 CTGTGGAACAAGGCTGGGGCAGG + Intergenic
1171134537 20:22684727-22684749 ATGAGGTAAGAGAGTGGGGATGG - Intergenic
1171257086 20:23697638-23697660 ATTTGGGAAAAGAGTGGAGAAGG + Intergenic
1171264448 20:23759493-23759515 ATTTGGGAAAAGAGTGGAGAAGG + Intergenic
1172935028 20:38614041-38614063 CTGTGGCAACAGGGTTGGGATGG - Intronic
1174103076 20:48141975-48141997 GTGTGGAAAAAAGGGGGGGAGGG + Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174600798 20:51723243-51723265 CTTGGGGAAAAGAGTGGGGAGGG + Intronic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175826927 20:61941610-61941632 CTGGGGAAATGAAGTGGGGAGGG - Intergenic
1176204301 20:63879725-63879747 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204343 20:63879925-63879947 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204351 20:63879965-63879987 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204368 20:63880045-63880067 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204376 20:63880085-63880107 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204392 20:63880165-63880187 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204418 20:63880285-63880307 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204435 20:63880365-63880387 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176204452 20:63880445-63880467 TTGTGCCTAAAGAGTGGGGATGG - Intronic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176978182 21:15348568-15348590 ATGTTGAAAAAGAGTAGTGAGGG - Intergenic
1177354726 21:19994187-19994209 CACTGGAAAAAGAGTTGTGAAGG - Intergenic
1177637197 21:23802638-23802660 CTGAAAAAAAAAAGTGGGGAAGG + Intergenic
1177860734 21:26450634-26450656 ATTTGAATAAAGAGTGGGGATGG + Intergenic
1178135238 21:29619475-29619497 CAGGGGGAAAAGAGTGGGAAGGG + Intronic
1178687717 21:34724271-34724293 GTGTGGAGAAGGGGTGGGGAAGG + Intergenic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1180674176 22:17575941-17575963 CTTTGGAAACAAAGTGGGAAAGG - Intronic
1181116402 22:20634844-20634866 CTGTGGAAAGAGGCTGGGGGTGG - Intergenic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181679110 22:24479164-24479186 CCCTAGAAATAGAGTGGGGATGG - Intergenic
1182599265 22:31447566-31447588 CTGCTGAAAAGGAGAGGGGAGGG + Intronic
1183592734 22:38789966-38789988 CTGGGGAAAAAGACTGGGGTTGG + Intronic
1184245740 22:43234989-43235011 CTCTGGAAAAACACTGGGAAAGG - Intronic
1184706195 22:46215150-46215172 CTGGGGAAAAAGAGGAGAGACGG - Intronic
949396110 3:3616080-3616102 ATGTGGAGAAAGAGGAGGGAGGG + Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
950211786 3:11128857-11128879 CTGGGGAAAAATGGTGGGAAAGG + Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950651043 3:14406856-14406878 CTGAAACAAAAGAGTGGGGAGGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951516755 3:23568083-23568105 CTGTGGAAAAACTGTGGTCAAGG - Intronic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
952503910 3:33989896-33989918 CAGAGGGAAAAGAGTGGGGACGG - Intergenic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
953831027 3:46297671-46297693 ATGTGGGAAAAGAGAGGGGGAGG - Intergenic
953843186 3:46406421-46406443 CTGTGGGAAGAGAGTGGGACGGG - Intergenic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955849192 3:63201888-63201910 CAGTAGAAAAAAAGGGGGGAAGG - Intergenic
957073082 3:75580741-75580763 CTGTGGACCAGGAGTGGTGATGG + Intergenic
957185029 3:76930322-76930344 CTGTGCACAAAGAGTGGGGAAGG - Intronic
957224278 3:77423587-77423609 CTGTCAGAAAAAAGTGGGGAGGG - Intronic
958624161 3:96603370-96603392 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
958803937 3:98786770-98786792 GGGTGGTAAAAGAGAGGGGAAGG + Intronic
959933217 3:112004339-112004361 CTGTGGACAGAAAGTGGGAAAGG + Intronic
960268603 3:115649875-115649897 CTGAGGGAAAAAAGAGGGGAGGG - Intronic
961467261 3:127089408-127089430 CTGTGGACAGAGGGTGGGGCAGG - Intergenic
962096441 3:132297506-132297528 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
962611124 3:137077046-137077068 TTGTGGCAAAAGAATGGGGCAGG + Intergenic
962672101 3:137718856-137718878 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
963020686 3:140870159-140870181 CTCTGGAGAAAGAGGGGGAAGGG + Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963562727 3:146886434-146886456 CAGTGCAAAAAGAGTTGGAAAGG - Intergenic
963808772 3:149753638-149753660 GTGTGGAGGAAGAGAGGGGAAGG + Intergenic
963884627 3:150567529-150567551 CAGTGGAAAAAGCATGGGGTAGG - Intronic
964182444 3:153904762-153904784 TTTTTGAAAAAGAGTGGGGTCGG + Intergenic
964749623 3:160042323-160042345 CAGTGGAATGGGAGTGGGGAGGG + Intergenic
965085931 3:164098245-164098267 GTGTTGAATAAGAGTGGTGAGGG + Intergenic
966400385 3:179541735-179541757 ATGTGGAAAGAGAGTAGGAAAGG + Intergenic
966809247 3:183828647-183828669 CTTTGGAAAAGGAGTGGGAGTGG - Intergenic
966885460 3:184375602-184375624 CTGTTGAAAAAGATTGGTGGGGG + Intronic
967430389 3:189378056-189378078 ATGTTGAAAAACAGTGGGAAGGG + Intergenic
967542786 3:190688687-190688709 CTGTTGAAGAAGGGTGGGAATGG + Intergenic
968146299 3:196301750-196301772 ATGTAAAAATAGAGTGGGGAGGG + Intronic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968835337 4:2959808-2959830 CTGCGGATAAAGAATGGTGAAGG - Intronic
968900673 4:3430248-3430270 CTGTGGGAAGATAGTGTGGACGG + Intronic
969369211 4:6720576-6720598 GTGTGCAGACAGAGTGGGGACGG + Intergenic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
970491433 4:16579004-16579026 CTGGAGATAGAGAGTGGGGATGG + Intronic
971628362 4:28954808-28954830 CAGTGGACAGAGAGTGTGGAGGG - Intergenic
972723562 4:41725357-41725379 CTGTTGAAAAGCAGTGGTGAGGG + Intergenic
973029931 4:45324949-45324971 GACTGGAAAAAGAGAGGGGAGGG - Intergenic
973163668 4:47050844-47050866 ATATGGAAAAAGAGAGTGGAAGG - Intronic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
974579390 4:63776287-63776309 TTTTGGAAAAAGAGTGGCAAAGG - Intergenic
975691860 4:76973297-76973319 CTGTGGAACAAGGCTGGGGCTGG - Intronic
976066624 4:81195104-81195126 CTGTGGAAATATAGAGGGAAGGG - Intronic
976129496 4:81870012-81870034 CTGTGGGTGAAGAGTGGGGTGGG + Intronic
977482220 4:97593237-97593259 CTGTGGGAGAAGAGTGGGGGTGG - Intronic
978237407 4:106475542-106475564 CTATGGGAGAAGAGTGTGGAAGG + Intergenic
978524094 4:109647003-109647025 CTATTAAAAAACAGTGGGGAGGG - Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
979562775 4:122119161-122119183 CTGTGGAGTAAGAGTGGAGAAGG + Intergenic
980569735 4:134598684-134598706 CTCAGGGAAAAGGGTGGGGATGG + Intergenic
980572726 4:134642046-134642068 CTCAGGAAAAAGAGTGGGAGGGG - Intergenic
980708659 4:136534892-136534914 CTCTGGAAAATGATAGGGGACGG - Intergenic
981849536 4:149213271-149213293 GTGAGGAAAAAAAGTGGGGGTGG - Intergenic
982964047 4:161879577-161879599 GTGTGGGACAAGAGTGAGGAAGG - Intronic
983172052 4:164547322-164547344 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
984212585 4:176868673-176868695 ATGTGGAGAATGAGTGGGAAGGG + Intergenic
984967597 4:185153890-185153912 CTGTTGAATAGGAGTGGTGAGGG - Intergenic
985259175 4:188099054-188099076 CTTGAGAAAAAGTGTGGGGAAGG - Exonic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985543744 5:499031-499053 CTGGGGACCAAGAGAGGGGAAGG + Intronic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986328890 5:6703007-6703029 GTCTGGAAAAAGAGAGGGGACGG - Intergenic
986573515 5:9189539-9189561 CACTGGACAAAGAATGGGGAGGG + Intronic
986822261 5:11480875-11480897 CTATGGAAAATGAGTGTAGAGGG + Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987287737 5:16475404-16475426 CTGTGGAGAAAGAGTGTTGCAGG - Intronic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
988012187 5:25502758-25502780 TTGTTAAAAAGGAGTGGGGAGGG + Intergenic
988125883 5:27036113-27036135 CTGTAGAAATATTGTGGGGAAGG + Intronic
988465618 5:31488725-31488747 CTGTGGAAACAGTGTGGGAATGG + Intronic
988626456 5:32880670-32880692 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
988861245 5:35282192-35282214 CTATGGAAAGAGAGAGGAGAGGG + Intergenic
988975537 5:36512135-36512157 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
989079841 5:37606941-37606963 CTGTCAAAAAAGAAAGGGGATGG - Intronic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989665257 5:43846441-43846463 TGGTGGAGAAATAGTGGGGAAGG + Intergenic
989690289 5:44135405-44135427 CTCTGGGGAAAGAGTGGGAAGGG - Intergenic
992232357 5:74675888-74675910 CAGAGGAAATTGAGTGGGGAGGG + Intronic
992579911 5:78162372-78162394 CTGAGGAAAAAGAATGTTGAAGG + Intronic
992766458 5:80005509-80005531 CTTTGTAAAAAGAGTGTGCACGG + Intronic
993948089 5:94138682-94138704 CTCAGGGAAAAGAGTGGGCAGGG - Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
996632281 5:125648197-125648219 CTTGGGAAAAAGACTGGGAAGGG + Intergenic
997139646 5:131364924-131364946 TTGAGGAAACGGAGTGGGGATGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997774509 5:136588869-136588891 CTGTTGGAACAGAGTGGGGCAGG + Intergenic
998142064 5:139705656-139705678 CTGGGGGGAAAGAGAGGGGAGGG - Intergenic
999311369 5:150554064-150554086 CTGTGGTAAAAGACTGAGGCAGG + Exonic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001818736 5:174693252-174693274 CTCTGGAAACACAGGGGGGAGGG - Intergenic
1001855115 5:175004086-175004108 ATCTGGAAAAAAAGTGGGGGTGG - Intergenic
1002526501 5:179818626-179818648 CTGAGGTGGAAGAGTGGGGAGGG - Intronic
1002587983 5:180264131-180264153 CTGTGGACAAAGGGTGGAGCTGG - Intronic
1002619097 5:180474396-180474418 CTATAGTAAAGGAGTGGGGATGG + Intergenic
1002998799 6:2311887-2311909 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1003004312 6:2366970-2366992 CTGTGGAAAAGCAGGGGGCAGGG - Intergenic
1005618015 6:27594008-27594030 GTCGGGAAAGAGAGTGGGGAAGG - Intergenic
1006191119 6:32210156-32210178 CTGTGGAAGAGGGGTTGGGAAGG + Intronic
1006404874 6:33839079-33839101 CTGGGGAAGAGGAGTGGGGGTGG - Intergenic
1007207903 6:40167490-40167512 CTGAGGAAGAAGAGTGGAGAAGG - Intergenic
1007276668 6:40679230-40679252 CTGTGGAGAAAGACTGTGGATGG - Intergenic
1007766747 6:44165219-44165241 CTGTGGAGAACTAGTGGGGGAGG + Intronic
1007797367 6:44360820-44360842 TTGTTGAAAAATATTGGGGAAGG - Intronic
1007931205 6:45692817-45692839 CTTGGGAGAAAGAGTGGGAAGGG + Intergenic
1008317873 6:50069263-50069285 CTGGGGAAAAAGAGTTGATATGG + Intergenic
1008408350 6:51144163-51144185 GTGTGTAAAAAGAGTGGAAAGGG - Intergenic
1009835901 6:69001491-69001513 GAGTAGAGAAAGAGTGGGGAAGG + Intronic
1010815863 6:80357346-80357368 CTGTTGAAACAGAATGGAGAGGG + Intergenic
1010935469 6:81855635-81855657 GTGTGGTTAAACAGTGGGGATGG + Intergenic
1011440184 6:87379268-87379290 AAGTGGAAGAAGAGTGGGCATGG - Intronic
1011557027 6:88581379-88581401 AGGAGGAAAAAAAGTGGGGAGGG - Intergenic
1011854325 6:91669761-91669783 CAGTGGGGAAAGAGAGGGGAGGG + Intergenic
1012218351 6:96616901-96616923 GTGTGGGGGAAGAGTGGGGAGGG - Intergenic
1012685542 6:102243487-102243509 GTGTGGAAAGAGAATGGAGAAGG - Intergenic
1012999519 6:106008493-106008515 TTGTGGCAAAAGAGTGTGAAAGG - Intergenic
1013474920 6:110498179-110498201 ATTTTGAAAGAGAGTGGGGAGGG - Intergenic
1014365223 6:120531907-120531929 CACTGGAAAAGCAGTGGGGATGG - Intergenic
1015029554 6:128578391-128578413 CTTTGGAAAAAGAGGTGTGATGG - Intergenic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016336223 6:143007783-143007805 ATGAGGAAACAGTGTGGGGAGGG + Intergenic
1016384352 6:143516083-143516105 CTGTGGAAACTGAGTGGTGGGGG + Intergenic
1016683954 6:146860695-146860717 CTGTGGAAAAAGAGAATGCATGG - Intergenic
1017065596 6:150526364-150526386 CTGTGGAAAAATTGTGAGGGAGG - Intergenic
1017284355 6:152657539-152657561 CTCTGGAAAAATAGTAGTGATGG - Intergenic
1017614530 6:156230352-156230374 CTGTGGGAGAAGTGTGGGGTTGG - Intergenic
1018494846 6:164338512-164338534 CTGTGGGATAACTGTGGGGAGGG - Intergenic
1019484234 7:1281323-1281345 CAGAGGAAAAAGCGTGGGAACGG + Intergenic
1020506057 7:8989567-8989589 CTGTTAGAAAAGAGTGGTGAGGG - Intergenic
1020659724 7:10967440-10967462 CTGTGGCAAAAGGCTGAGGAAGG - Intergenic
1020917080 7:14207811-14207833 ATGTGGAACAAAAGAGGGGAAGG + Intronic
1021024959 7:15654447-15654469 ATGTTGAATAAGAGTGGTGAGGG + Intronic
1021694367 7:23261943-23261965 CAGTGGGAAAAGGGTGGTGATGG - Intronic
1021830118 7:24598016-24598038 CTGTGGAAAATAAGAGGTGAGGG + Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022570937 7:31453709-31453731 CTAAGGAAAAAAAGTGGGGGAGG + Intergenic
1022822814 7:33977940-33977962 CTCTGGCAGAAGAGTGCGGAGGG + Intronic
1022891676 7:34707466-34707488 CTGTGGAAACTGAGTGAGGCAGG - Intronic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023762162 7:43475042-43475064 CTGGGGAAGGAGAGTGGTGATGG + Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024337719 7:48226075-48226097 CTGTAGAAAAGGAGTGGGGTTGG + Intronic
1026269319 7:68822665-68822687 CTGTGGCAGAAGAGTGGCCAGGG + Intergenic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1027540681 7:79460329-79460351 CAGTATATAAAGAGTGGGGAAGG + Intergenic
1027663366 7:81014728-81014750 CTATGGATATAGAGTTGGGATGG + Intergenic
1027666696 7:81048994-81049016 CTGAGGACAAAGTGTTGGGATGG + Intergenic
1028060760 7:86311950-86311972 CTGTGGAAATAGAGTCTTGATGG + Intergenic
1028315847 7:89401650-89401672 CTGTGGAAAAAAATAGGAGAAGG + Intergenic
1028977343 7:96928913-96928935 GTATGGAGTAAGAGTGGGGAAGG + Intergenic
1029137259 7:98382244-98382266 ATTTGAAAAAAGAGTGGGGAGGG + Intronic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1029635082 7:101778274-101778296 CTGTGCAAAAAGCGTTGGAATGG + Intergenic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030658765 7:112196634-112196656 CTGGTGACAGAGAGTGGGGAAGG + Intronic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031519591 7:122747279-122747301 CTATGGAAAAAAGGAGGGGAAGG + Intronic
1031800175 7:126233322-126233344 CTTTGGAAAAACAGAGAGGAAGG + Intergenic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032268481 7:130384282-130384304 CGGGTGAAAGAGAGTGGGGAAGG - Intronic
1033561801 7:142539027-142539049 CTATGGAAAAAGGGGTGGGAGGG + Intergenic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036711261 8:11080355-11080377 CTTTAGAAACAGGGTGGGGAAGG + Intronic
1037162801 8:15793348-15793370 CAGGGGAAAAGGAGTGGAGAAGG - Intergenic
1037178090 8:15970859-15970881 CTGAAGAAAAAGGGTGGAGATGG + Intergenic
1037779218 8:21856223-21856245 CTGAGGCAAAAGGTTGGGGAGGG - Intergenic
1038419199 8:27421461-27421483 CTCTGGGGAAAGAGTGGGAAGGG - Intronic
1039032409 8:33324720-33324742 TTGTGGGAGAAGAGTGGGGTTGG - Intergenic
1039352332 8:36776534-36776556 CTCTGGAAAAAAAGTGGAAAGGG - Intergenic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1041302580 8:56428602-56428624 ATGTTGAACAAGAGTGGTGAGGG + Intergenic
1041729894 8:61052684-61052706 CTCTGGAGAAATAATGGGGATGG + Intergenic
1042719251 8:71809235-71809257 CGGTGGAAAGAAAGTAGGGATGG - Intergenic
1043988413 8:86721406-86721428 CTATGGGGAAAGAGTGGGAAGGG + Intronic
1044175710 8:89119341-89119363 AGGAGGAAACAGAGTGGGGAGGG - Intergenic
1044430157 8:92098978-92099000 CTGTGGAAAAAAAGTGAAGTTGG + Intronic
1044628059 8:94253925-94253947 TTGTGAAAATAGAGTGGGGATGG - Intronic
1044974224 8:97647522-97647544 CTGTCTAAAAAAAGGGGGGAAGG + Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1046050491 8:109015930-109015952 CTGAGGAAAAAAAGTGGAGATGG - Intergenic
1046276110 8:111962431-111962453 CTGTGGTAAAAGAGTGTGCTTGG + Intergenic
1047005314 8:120614084-120614106 CTGTGGATAAACAGTGTGCATGG - Intronic
1047526446 8:125638198-125638220 TTGTGGAGAAAGACTGGGAAGGG + Intergenic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1048771126 8:137896687-137896709 CTGTGGAACAAAAGTGTGGAAGG - Intergenic
1050310281 9:4345671-4345693 CTCTGGAAAATGAGTTTGGAGGG - Intronic
1051366355 9:16324150-16324172 CTGAGGAAAAAGGAAGGGGAGGG + Intergenic
1051539003 9:18193516-18193538 TAAAGGAAAAAGAGTGGGGAGGG - Intergenic
1051817266 9:21122424-21122446 CTGTTGGAAAAGGGTGGGGATGG - Intergenic
1052508395 9:29383178-29383200 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1052979417 9:34437395-34437417 CTGTGGAAGGACACTGGGGATGG - Intronic
1053348400 9:37395091-37395113 CTGTGGGAATAGGGTGGGAATGG + Intergenic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1054754409 9:68942913-68942935 CTGTGGAAAGGCAGTGGGCATGG + Intronic
1054805284 9:69391578-69391600 CTTTGGGAAAAGAGAGGGGTGGG - Intronic
1054849423 9:69831560-69831582 CTGTGAGATAGGAGTGGGGAGGG + Intronic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055752095 9:79517849-79517871 CTGAGGAAAAAGAATAGGCAAGG + Intergenic
1056946444 9:91001612-91001634 CTGTTGAAAAAGAGTGGAGGTGG - Intergenic
1057014364 9:91638086-91638108 CTGTGGAATTAGAGTTGAGATGG + Intronic
1057432490 9:95006653-95006675 CTGTGGAAAAAGAAAAGGGGTGG - Intronic
1057875162 9:98747998-98748020 CTTTGGAGAAAGAGGGGGAACGG - Intronic
1058020996 9:100088520-100088542 CTGTGGAAAAAGAAAAGGTAGGG - Intronic
1058310382 9:103493563-103493585 GTGTTGAAGAAGAGTGGGTAAGG + Intergenic
1058504342 9:105653350-105653372 GGGTGGGAAAAGAATGGGGACGG + Intergenic
1059099563 9:111456824-111456846 ATGGGTAAAAAGAGTGGAGAGGG + Intronic
1059268430 9:113057382-113057404 TACTGGAAAAAGAGTGGAGAGGG + Intergenic
1059342056 9:113602856-113602878 CTGGGGGTAAAAAGTGGGGATGG - Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1060231427 9:121828113-121828135 CTGTGGACAAAGAGTAAGGGTGG - Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060428595 9:123527348-123527370 CTGTGGAGAAAGAGTTTGTAAGG - Intronic
1060571159 9:124641708-124641730 CTGTGGGAAATTAGTTGGGAAGG + Intronic
1060847132 9:126846495-126846517 CTGTGGAAATACAGTAGGAAAGG + Intergenic
1060946741 9:127574189-127574211 CTGTGGACAAAGGGTGGCAATGG + Intronic
1060962587 9:127691546-127691568 CTGTGGACACAGGCTGGGGAGGG - Exonic
1061054969 9:128217741-128217763 GGGTTGAAGAAGAGTGGGGAAGG - Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1061431241 9:130532725-130532747 CTGGGGGAAAAGAGGCGGGATGG + Intergenic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1185502922 X:612586-612608 CTTGGGGAAAAGAGTGGGAAGGG - Intergenic
1186115320 X:6299505-6299527 CTGTGGAAAAAAAATAGGAATGG - Intergenic
1186637480 X:11422029-11422051 CAGTGGAAAGACAGTGGGAAAGG + Intronic
1186946666 X:14576183-14576205 CAGTGGAAAAAAAGTGGTAAAGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187223771 X:17356066-17356088 CTGTTAAAAAAGTGTGGGCAGGG + Intergenic
1187268078 X:17755541-17755563 CTGGGGAACAAGAGTAGTGAGGG - Intergenic
1187948756 X:24451718-24451740 TGGAGGAAAAAGAGTGGGGAGGG - Intergenic
1188732953 X:33674554-33674576 CTTGGGAGGAAGAGTGGGGATGG - Intergenic
1189112534 X:38307264-38307286 CTGTGGAAAAAGTCTGAGGCTGG - Intronic
1189209563 X:39273140-39273162 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1189417656 X:40829285-40829307 TTGGGGTAGAAGAGTGGGGAGGG + Intergenic
1190771555 X:53518958-53518980 CTGTACAGCAAGAGTGGGGAAGG + Intergenic
1190934472 X:54984156-54984178 CTATGTCAAAAGAGTGGAGAAGG - Intronic
1191209665 X:57871741-57871763 CTGTAGAATATGAGTGGGTAGGG + Intergenic
1192179848 X:68909555-68909577 CTGTGGGAAAAGGGCTGGGATGG + Intergenic
1192771015 X:74190738-74190760 ATGTGGAATAAAAGTGGTGAAGG + Intergenic
1194037999 X:88902766-88902788 CTGTGGAGATATATTGGGGATGG + Intergenic
1194115109 X:89887397-89887419 ATGTGGAAGAACAGTGGTGAAGG + Intergenic
1194249383 X:91555271-91555293 TTTTGGAAAAAAAGTAGGGAGGG + Intergenic
1194540179 X:95159998-95160020 CTGTGGTCCAAGAGTGTGGATGG - Intergenic
1195468523 X:105208470-105208492 GTGTGGTGAGAGAGTGGGGATGG - Intronic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196459747 X:115917916-115917938 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1197162729 X:123342251-123342273 TTCAGGAAATAGAGTGGGGATGG - Intronic
1197326584 X:125101989-125102011 CAAAGAAAAAAGAGTGGGGAAGG + Intergenic
1198788837 X:140320082-140320104 CTCTGGAGAAAGAATGGAGATGG + Intergenic
1198960984 X:142182956-142182978 TTGTGGACATAGAGTGTGGAAGG + Intergenic
1199581049 X:149360704-149360726 GTGTGGAATAACAGTGGTGAAGG + Intergenic
1199876021 X:151929154-151929176 CTGAGGAAGAAAAGTGGGAAGGG + Intergenic
1199997021 X:153031867-153031889 CTGTGGGAAACTAGTGGGAAAGG + Intergenic
1200568339 Y:4796490-4796512 TTTTGGAAAAAAAGTAGGGAGGG + Intergenic
1200925562 Y:8651322-8651344 CTGTGGAAGAACAGTGGTGTTGG + Intergenic
1201259836 Y:12148176-12148198 CTGTATAGCAAGAGTGGGGAAGG - Intergenic