ID: 1064644079

View in Genome Browser
Species Human (GRCh38)
Location 10:17442930-17442952
Sequence CTGCTGTTCTAGATTATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064644075_1064644079 19 Left 1064644075 10:17442888-17442910 CCAAAAACCTAGACAAGGCAACA 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG No data
1064644074_1064644079 22 Left 1064644074 10:17442885-17442907 CCTCCAAAAACCTAGACAAGGCA 0: 1
1: 0
2: 0
3: 15
4: 210
Right 1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG No data
1064644076_1064644079 12 Left 1064644076 10:17442895-17442917 CCTAGACAAGGCAACAAAACTCA 0: 1
1: 0
2: 0
3: 17
4: 230
Right 1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064644079 Original CRISPR CTGCTGTTCTAGATTATAAA TGG Intronic
No off target data available for this crispr