ID: 1064646382

View in Genome Browser
Species Human (GRCh38)
Location 10:17464350-17464372
Sequence TTTTTTCCACAGATGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064646382_1064646392 20 Left 1064646382 10:17464350-17464372 CCCCACTCCATCTGTGGAAAAAA No data
Right 1064646392 10:17464393-17464415 CCCTGGTACCAAAATGATTGGGG No data
1064646382_1064646390 19 Left 1064646382 10:17464350-17464372 CCCCACTCCATCTGTGGAAAAAA No data
Right 1064646390 10:17464392-17464414 TCCCTGGTACCAAAATGATTGGG No data
1064646382_1064646386 3 Left 1064646382 10:17464350-17464372 CCCCACTCCATCTGTGGAAAAAA No data
Right 1064646386 10:17464376-17464398 TCTTCCACAAAACCAGTCCCTGG 0: 248
1: 553
2: 1109
3: 1150
4: 1512
1064646382_1064646389 18 Left 1064646382 10:17464350-17464372 CCCCACTCCATCTGTGGAAAAAA No data
Right 1064646389 10:17464391-17464413 GTCCCTGGTACCAAAATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064646382 Original CRISPR TTTTTTCCACAGATGGAGTG GGG (reversed) Intergenic
No off target data available for this crispr