ID: 1064647914

View in Genome Browser
Species Human (GRCh38)
Location 10:17479013-17479035
Sequence CAGAGCGTGGAAAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064647914_1064647920 22 Left 1064647914 10:17479013-17479035 CCTGACCACTTTTCCACGCTCTG No data
Right 1064647920 10:17479058-17479080 ACAATCCCTGAGATCATCTCTGG No data
1064647914_1064647919 -8 Left 1064647914 10:17479013-17479035 CCTGACCACTTTTCCACGCTCTG No data
Right 1064647919 10:17479028-17479050 ACGCTCTGTAGGTGGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064647914 Original CRISPR CAGAGCGTGGAAAAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr