ID: 1064649441

View in Genome Browser
Species Human (GRCh38)
Location 10:17493674-17493696
Sequence ATGGTAATATTTCCTAAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064649441_1064649445 8 Left 1064649441 10:17493674-17493696 CCCCGCTTAGGAAATATTACCAT No data
Right 1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064649441 Original CRISPR ATGGTAATATTTCCTAAGCG GGG (reversed) Intergenic
No off target data available for this crispr