ID: 1064649442

View in Genome Browser
Species Human (GRCh38)
Location 10:17493675-17493697
Sequence GATGGTAATATTTCCTAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064649442_1064649445 7 Left 1064649442 10:17493675-17493697 CCCGCTTAGGAAATATTACCATC No data
Right 1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064649442 Original CRISPR GATGGTAATATTTCCTAAGC GGG (reversed) Intergenic
No off target data available for this crispr