ID: 1064649445

View in Genome Browser
Species Human (GRCh38)
Location 10:17493705-17493727
Sequence TAAACCAGACTGCTGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064649439_1064649445 28 Left 1064649439 10:17493654-17493676 CCTCTGATAGAAATATACAACCC No data
Right 1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG No data
1064649443_1064649445 6 Left 1064649443 10:17493676-17493698 CCGCTTAGGAAATATTACCATCA No data
Right 1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG No data
1064649441_1064649445 8 Left 1064649441 10:17493674-17493696 CCCCGCTTAGGAAATATTACCAT No data
Right 1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG No data
1064649442_1064649445 7 Left 1064649442 10:17493675-17493697 CCCGCTTAGGAAATATTACCATC No data
Right 1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064649445 Original CRISPR TAAACCAGACTGCTGAAGCA AGG Intergenic
No off target data available for this crispr