ID: 1064668400

View in Genome Browser
Species Human (GRCh38)
Location 10:17682154-17682176
Sequence TAGTACTTGCATAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 500}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064668400 Original CRISPR TAGTACTTGCATAAGGTGGA AGG (reversed) Intronic
901946594 1:12709084-12709106 GAGTACTTGCATAACCAGGAAGG - Intergenic
901981596 1:13039277-13039299 TAATTTTTGCATAAGGTGAAAGG + Intronic
902000486 1:13189636-13189658 TAATTTTTGCATAAGGTGAAAGG - Intergenic
902019730 1:13335403-13335425 TAATTTTTGCATAAGGTGAAAGG - Intergenic
902742778 1:18451034-18451056 TAATTTTTGCATAAGGTGTATGG - Intergenic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
906358766 1:45133777-45133799 TAGTTTTTGTATAAGGTGTAAGG + Intronic
906361834 1:45167297-45167319 TAGTTTTTGTATAAGGTGTAAGG - Intronic
906736469 1:48134027-48134049 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
906759687 1:48364965-48364987 TAGTTTTTGTATAAGGTGTAAGG + Intronic
906881986 1:49601677-49601699 TAATTTTTGCATAAGGTGTAGGG - Intronic
906970894 1:50512406-50512428 TAATTTTTGTATAAGGTGGAAGG + Intronic
907371878 1:54009067-54009089 CAGTACTTGAAGAAGGTTGAAGG + Exonic
907566114 1:55435644-55435666 TAATTCTTGTATAAGGTGTAAGG - Intergenic
907684500 1:56596901-56596923 TAGTTTTTGTATAAGGTGTAAGG + Intronic
908099264 1:60773697-60773719 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
908888878 1:68819912-68819934 TAGTGCTTGCATAGGGTTGGGGG + Intergenic
909324357 1:74331305-74331327 GAGGTCTTGGATAAGGTGGATGG + Intronic
909535898 1:76735784-76735806 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
909861461 1:80610916-80610938 TAATTTTTGTATAAGGTGGAAGG + Intergenic
910111244 1:83685681-83685703 TAATTTTTGCATAAGGTGTAAGG + Intergenic
910915550 1:92284445-92284467 TAATTTTTGCATAAGGTGTAAGG - Intronic
911233882 1:95388845-95388867 CAGAACTTGCTCAAGGTGGAGGG - Intergenic
911252130 1:95588791-95588813 TAGTTTTTGTATAAGGTGTACGG - Intergenic
912646606 1:111398713-111398735 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
912781827 1:112557262-112557284 TAGTAGTTGCTTAAGGGGGTTGG - Intronic
913418970 1:118642727-118642749 TAATTTTTGCATAAGGTGTAAGG - Intergenic
913580317 1:120220152-120220174 TAATTCTTGTATAAGGTGTAAGG + Intergenic
913627863 1:120678246-120678268 TAATTCTTGTATAAGGTGTAAGG - Intergenic
914562242 1:148831589-148831611 TAGTTCTTGTATAAGGTGTAAGG + Intronic
914610587 1:149298633-149298655 TAGTTCTTGTATAAGGTGTAAGG - Intergenic
916467810 1:165089920-165089942 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
916612202 1:166403452-166403474 TAATTTTTGCATAAGGTGTAAGG + Intergenic
916768676 1:167886522-167886544 TAATTTTTGTATAAGGTGGAAGG - Intronic
916836340 1:168549516-168549538 TAATTTTTGTATAAGGTGGAAGG - Intergenic
916865941 1:168858730-168858752 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
916970471 1:170008093-170008115 TAATATTTGTATAAGGTGTAAGG - Intronic
917111348 1:171551628-171551650 TAGTTTTTGTATAAGGTGTAAGG + Intronic
917218785 1:172705381-172705403 TAGTACTTTAATATGGTTGACGG + Intergenic
917311098 1:173679521-173679543 TAATTTTTGCATAAGGTGTAAGG - Intergenic
917584438 1:176411822-176411844 TAGTTTTTGTATAAGGTGAAAGG + Intergenic
917799905 1:178560985-178561007 TAGTACTTGGATGGGGGGGATGG + Intergenic
917914241 1:179685210-179685232 TAGTTTTTGTATAAGGTGTAAGG + Intronic
919154708 1:193748996-193749018 TAATTTTTGCATAAGGTGTAAGG + Intergenic
919303598 1:195801590-195801612 TAATTTTTGCATAAGGTGTAAGG - Intergenic
919609869 1:199732031-199732053 TAATATTTGTATAAGGTGTAAGG - Intergenic
920522860 1:206641752-206641774 TAATTTTTGCATAAGGTGTAGGG - Intronic
920772796 1:208905535-208905557 GAGTACTTGCACAAGCTTGAAGG - Intergenic
921886245 1:220309490-220309512 TAATTTTTGCATAAGGTGCAAGG - Intergenic
922403305 1:225284079-225284101 TGGTATTTTCCTAAGGTGGAAGG - Intronic
922622261 1:226998619-226998641 TAATTTTTGCATAAGGTGTAAGG - Intronic
923060801 1:230471801-230471823 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
923347723 1:233072309-233072331 TAATATTTGCATATGGTGTAAGG + Intronic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
924252930 1:242153517-242153539 TAATATTTGTATAAGGTGTAAGG + Intronic
924893616 1:248312068-248312090 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1063294834 10:4794752-4794774 TAATTTTTGCATAAGGTGCAAGG + Intronic
1063302365 10:4862097-4862119 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1064623235 10:17236081-17236103 TAGTACTTGCAGCAGGAAGAAGG - Intronic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1064925030 10:20560397-20560419 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1064968494 10:21039392-21039414 TAATATTTGTATAAGGTGTAAGG + Intronic
1065062049 10:21912426-21912448 GAGTACTTGCATAAGATGCAAGG + Intronic
1065900456 10:30202527-30202549 TAGTATTTGCATTATTTGGAGGG - Intergenic
1066472703 10:35714640-35714662 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1066582277 10:36894123-36894145 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1066786604 10:39011240-39011262 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1067663398 10:48253276-48253298 TAATTTTTGCATAAGGTGCAAGG - Intronic
1067771060 10:49126027-49126049 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1068125708 10:52839865-52839887 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1068493131 10:57749406-57749428 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1068562212 10:58527589-58527611 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1068575609 10:58680997-58681019 TAATTTTTGCATAAGGTGTAAGG - Intronic
1069367885 10:67712758-67712780 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1070062195 10:72994840-72994862 TAATATTTGTATAAGGTGTAAGG - Intergenic
1070439238 10:76426769-76426791 TAATTTTTGCATAAGGTGTAAGG + Intronic
1071004446 10:80866359-80866381 TAATATTTGTATAAGGTGTAAGG + Intergenic
1073164692 10:101435362-101435384 CAGTAATTGCATATGGGGGATGG - Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074646162 10:115455460-115455482 TAATTTTTGCATAAGGTGTAAGG - Intronic
1074925615 10:118067188-118067210 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1077742226 11:4859046-4859068 TAATTTTTGCATAAGGTGTAAGG - Intronic
1079191559 11:18281899-18281921 TAGTGCTTGGAGAAGGTAGAAGG - Intronic
1079683392 11:23325934-23325956 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1079798313 11:24835283-24835305 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1079838527 11:25365578-25365600 TAATATTTGTATAAGGTGTAAGG - Intergenic
1081181309 11:39989004-39989026 TAATATTTGTATAAGGTGTAAGG - Intergenic
1081257552 11:40915520-40915542 TAATTCTTGTATAAGGTGTAAGG - Intronic
1081363712 11:42210117-42210139 TAATATTTGTATAAGGTGTAAGG - Intergenic
1082292142 11:50388824-50388846 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1082581222 11:54871911-54871933 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1082938939 11:58683536-58683558 TAATTTTTGCATAAGGTGTAAGG - Intronic
1083497209 11:63066471-63066493 TAATATTTGTATAAGGTGTAAGG + Intergenic
1084250103 11:67891348-67891370 AAGTATTTGCCTAAGCTGGATGG + Intergenic
1086231082 11:84570615-84570637 TAGGTCTTTCATAAAGTGGAAGG - Intronic
1086601240 11:88636718-88636740 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1087311570 11:96549985-96550007 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1087548199 11:99611674-99611696 AAGTAGTTGAAAAAGGTGGATGG + Intronic
1087846521 11:102979795-102979817 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1088419082 11:109622300-109622322 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1088926288 11:114306515-114306537 TAATTTTTGCATAAGGTGTAAGG + Intronic
1089193299 11:116671676-116671698 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1089244898 11:117111596-117111618 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1090308449 11:125712672-125712694 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1090720873 11:129472009-129472031 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1091052753 11:132388380-132388402 TAATATTTGTATAAGGTGTAAGG - Intergenic
1091895667 12:4102082-4102104 TAGTAGTTGCCAAAGGTTGAGGG + Intergenic
1092827040 12:12410393-12410415 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1094635176 12:32220067-32220089 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1095224610 12:39665239-39665261 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1095664857 12:44785853-44785875 TAATTTTTGCATAAGGTGTAAGG - Intronic
1097528618 12:60770600-60770622 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1098906172 12:76164872-76164894 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1099591142 12:84592191-84592213 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1099631358 12:85149317-85149339 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1099920282 12:88949122-88949144 TAATATTTGTATAAGGTGTAAGG - Intergenic
1100068929 12:90686652-90686674 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1101704974 12:107213058-107213080 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1104140339 12:125981777-125981799 GAGAACTTGCACAAGGGGGAGGG - Intergenic
1107395173 13:40007902-40007924 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1107451215 13:40511844-40511866 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1107681665 13:42858102-42858124 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1107775343 13:43834283-43834305 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1108656853 13:52541927-52541949 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1109565895 13:64116059-64116081 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1109572586 13:64212221-64212243 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1109835121 13:67847456-67847478 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1109949160 13:69479029-69479051 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1110495281 13:76160941-76160963 TACCACTTGCTTAAGCTGGAGGG + Intergenic
1110631472 13:77713034-77713056 TAATTTTTGCATAAGGTGTAAGG - Intronic
1110656223 13:78003285-78003307 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1110898411 13:80787078-80787100 TAGTACCTGGATGAGGGGGAGGG + Intergenic
1110938914 13:81324307-81324329 TAGTTGTTGAATAGGGTGGAAGG + Intergenic
1110972779 13:81787376-81787398 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1111092636 13:83466773-83466795 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1111699762 13:91672067-91672089 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1112081537 13:95977024-95977046 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1112141993 13:96654375-96654397 TAATTTTTGCATAAGGTGTAAGG + Intronic
1112911803 13:104494496-104494518 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1114030212 14:18572216-18572238 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1114156438 14:20108622-20108644 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1114964715 14:27942850-27942872 TAATATTTGTATAAGGTGTAAGG - Intergenic
1115008876 14:28520519-28520541 TAGTTTTTGCATATGGTGTAAGG + Intergenic
1115729096 14:36248749-36248771 TAATATTTGTATAAGGTGTAAGG - Intergenic
1115873970 14:37839814-37839836 TAATTTTTGTATAAGGTGGAAGG + Intronic
1116432140 14:44858389-44858411 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1116730204 14:48611658-48611680 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1116770998 14:49127008-49127030 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1116791554 14:49345279-49345301 AAGTACTTCCATAATGTGGAAGG + Intergenic
1118027621 14:61785751-61785773 TATTATTTGTATTAGGTGGAAGG - Intronic
1118478392 14:66140567-66140589 TAGTACTTGTTTGATGTGGATGG + Intergenic
1119677069 14:76563688-76563710 AAGTACTTGCATTTGGGGGAAGG + Intergenic
1120478483 14:85019558-85019580 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1121029959 14:90649806-90649828 TAGATATTGCATAATGTGGATGG - Intronic
1121470287 14:94147859-94147881 TAATATTTGTATAAGGTGTAAGG + Intronic
1121890732 14:97588115-97588137 TAGTAATGGCAGAAGGTGAAGGG + Intergenic
1123148687 14:106159631-106159653 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1202884432 14_KI270722v1_random:90942-90964 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1126136686 15:45399494-45399516 TTGTACCTGCACATGGTGGAAGG - Intronic
1127180813 15:56415402-56415424 TGGTCTTTGTATAAGGTGGAAGG + Intronic
1127189094 15:56510698-56510720 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1127212553 15:56788903-56788925 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1127491320 15:59466873-59466895 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1129012115 15:72429528-72429550 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1129957198 15:79649606-79649628 GAATATTTGCATAAGGTGTAAGG - Intergenic
1131777836 15:95821935-95821957 TATCACTTGCATATTGTGGAAGG - Intergenic
1131917127 15:97279897-97279919 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1138702057 16:58874298-58874320 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1139136422 16:64210211-64210233 TAATACTTGGAAAAGGTGGAGGG - Intergenic
1139138072 16:64229091-64229113 TAGGAATTCCAAAAGGTGGAGGG - Intergenic
1140789489 16:78377235-78377257 CAGTACTTGCATAAGATATAGGG + Intronic
1141170757 16:81689821-81689843 TAATTTTTGCATAAGGTGTAAGG + Intronic
1141245671 16:82304586-82304608 TAATATTTGTATAAGGTGTAAGG + Intergenic
1141415428 16:83868518-83868540 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1142943638 17:3405581-3405603 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1146562372 17:33882084-33882106 TAATTTTTGCATAAGGTGTAAGG - Intronic
1146743709 17:35309164-35309186 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1147035826 17:37679745-37679767 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1148644057 17:49209266-49209288 TAGGACTTGCCTCAGGAGGAAGG - Intronic
1203170309 17_GL000205v2_random:142493-142515 TAATCTTTGCATAAGGTGTAAGG + Intergenic
1153511877 18:5863635-5863657 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1153752820 18:8250990-8251012 TAGTACATGCATATGGAAGAGGG - Intronic
1154393344 18:13963435-13963457 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1154401141 18:14038755-14038777 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1155735743 18:29220259-29220281 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1155848225 18:30735912-30735934 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1156026427 18:32660174-32660196 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1157219133 18:45812743-45812765 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1158085179 18:53642593-53642615 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1158190329 18:54820783-54820805 TAATTTTTGCATAAGGTGTAAGG + Intronic
1159172081 18:64783865-64783887 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1202659840 1_KI270708v1_random:58071-58093 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
925228098 2:2204085-2204107 TAATTTTTGCATAAGGTGTAAGG - Intronic
925244796 2:2372039-2372061 TAATTTTTGCATAAGGTGTAAGG + Intergenic
925282335 2:2693352-2693374 TATTAATGGCATAAGGTGGTGGG - Intergenic
927440200 2:23110156-23110178 TAATATTTGTATAAGGTGTAAGG + Intergenic
928354410 2:30596809-30596831 TAATTTTTGCATAAGGTGTAAGG + Intronic
928355209 2:30606562-30606584 TAATTTTTGCATAAGGTGTAAGG - Intronic
928368170 2:30719107-30719129 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
928795810 2:35017405-35017427 TAATATTTGTATAAGGTGTAAGG - Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929280746 2:40075476-40075498 TAATATTTGTATAAGGTGTAAGG + Intergenic
929374770 2:41272684-41272706 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
930277151 2:49325125-49325147 TAGTTCTTGCATTAGATGAAGGG + Intergenic
933237271 2:79878987-79879009 TAGTTTTTGCATAAGGTGTAAGG + Intronic
934250639 2:90351516-90351538 TAATTTTTGCATAAGGTGTAAGG + Intergenic
934258927 2:91451894-91451916 TAATTTTTGCATAAGGTGTAAGG - Intergenic
934622132 2:95818686-95818708 TAATTTTTGCATAAGGTGTAAGG + Intergenic
935067232 2:99659872-99659894 TAGTGCTTTCATCTGGTGGAGGG - Intronic
936256425 2:110918383-110918405 TAATTTTTGCATAAGGTGTAAGG - Intronic
936262590 2:110974462-110974484 TAGTAATTGGATTTGGTGGAGGG - Intronic
936774902 2:115961210-115961232 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
936931696 2:117796546-117796568 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
938916070 2:135941483-135941505 TAATTCTTGTATAAGGTGTAAGG - Intronic
938951811 2:136261594-136261616 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
940760221 2:157730613-157730635 TAATTTTTGCATAAGGTGTAAGG - Intergenic
941513740 2:166445852-166445874 TAGTTTTTGTATATGGTGGAAGG - Intronic
941779740 2:169431125-169431147 TAATATTTGTATAAGGTGTAAGG - Intergenic
942350081 2:175043204-175043226 TAATTTTTGCATAAGGTGTAAGG + Intergenic
942716811 2:178902580-178902602 TAATTTTTGCATAAGGTGTAAGG - Intronic
942955468 2:181767799-181767821 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
943191868 2:184687188-184687210 TAGTTTTTGCATATGGTGAAAGG + Intronic
943296525 2:186147278-186147300 TAATATTTGTATAAGGTGTAAGG - Intergenic
944019161 2:195079921-195079943 TAGGAATTACATAAGGTGGTTGG - Intergenic
945329284 2:208520717-208520739 TAATTTTTGTATAAGGTGGAAGG + Intronic
945481974 2:210355580-210355602 TAATTTTTGCATAAGGTGTAAGG - Intergenic
945524452 2:210870890-210870912 TAATTTTTGCATAAGGTGTAAGG - Intergenic
945579762 2:211578778-211578800 TAGTTTTTGTATAAGGTGTAAGG - Intronic
947365123 2:229386295-229386317 TAGTTTTTGTATAAGGTGTAAGG - Intronic
947666514 2:231909354-231909376 TAGTACTTGCATAACATGCGTGG - Intergenic
947943623 2:234080747-234080769 TAATATTTGTATAAGGTGTAAGG + Intergenic
1169261246 20:4139935-4139957 TAATTTTTGCATAAGGTGTAAGG + Intronic
1169577496 20:6981455-6981477 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1169658483 20:7952702-7952724 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1170076384 20:12423838-12423860 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1170638073 20:18126622-18126644 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1170985509 20:21254383-21254405 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1171397998 20:24851371-24851393 TAATTTTTGCATATGGTGGAAGG - Intergenic
1171499530 20:25582956-25582978 TAATTTTTGCATAAGGTGTAAGG - Intronic
1171722062 20:28572995-28573017 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1171764796 20:29254143-29254165 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1173750695 20:45473348-45473370 TAATTTTTGCATAAGGTGTAAGG + Intronic
1175591562 20:60196584-60196606 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1176326300 21:5504324-5504346 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1176401457 21:6316627-6316649 TAATGTTTGCATAAGGTGTAAGG - Intergenic
1176435700 21:6672477-6672499 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1176459962 21:6999547-6999569 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1176483523 21:7381325-7381347 TAATGTTTGCATAAGGTGTAAGG + Intergenic
1177025336 21:15915747-15915769 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1177530002 21:22346248-22346270 TAGGACTGGCTTAAGGAGGAGGG + Intergenic
1177969860 21:27776618-27776640 TAATACTTCCTTCAGGTGGAAGG - Intergenic
1178160160 21:29903106-29903128 TAATTTTTGCATAAGGTGTAAGG - Intronic
1178216811 21:30607913-30607935 TAATTTTTGCATAAGGTGCAAGG - Intergenic
1178344019 21:31809669-31809691 TAGTGGTTGCCTAAGGTTGAGGG + Intergenic
1180047415 21:45315393-45315415 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1180295615 22:10931678-10931700 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1180327314 22:11441633-11441655 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1180454326 22:15499266-15499288 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1182229436 22:28826118-28826140 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1182817255 22:33176128-33176150 TAGTTTTTGTATAAGGTGTAAGG - Intronic
950310206 3:11951060-11951082 TAGTGATTGCATAGGGTGGGAGG + Intergenic
950375508 3:12568945-12568967 TAGTACTTGCAGATGGTGGACGG - Exonic
951378287 3:21950713-21950735 TAATTTTTGCATAAGGTGTAAGG + Intronic
955261077 3:57391044-57391066 TAGTACTTGGAAAAGGAGAAGGG - Intronic
956269876 3:67440205-67440227 TAGTTTTTGCATAAAGTGTAAGG - Intronic
956918835 3:73904492-73904514 TACTTTTTGTATAAGGTGGAAGG - Intergenic
956976674 3:74588930-74588952 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
957029522 3:75223870-75223892 TAGTACTTGCCTCATGTTGAAGG + Intergenic
957116236 3:76030533-76030555 TAGTTTTTGTATAAGGTGTAAGG + Intronic
957172123 3:76751277-76751299 TAGTTTTTGTATAAGGTGCAAGG - Intronic
957748070 3:84371524-84371546 TAATATTTGTATAAGGTGTAAGG - Intergenic
958012913 3:87903099-87903121 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
958527630 3:95284110-95284132 TAATATTTGTATAAGGTGTAAGG + Intergenic
958811649 3:98866873-98866895 TAGTTTTTGCATAAGGTGTAAGG + Intronic
959091379 3:101906604-101906626 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
959092620 3:101920222-101920244 TAGTTTTTGCATAAGGTGTAAGG + Intergenic
959778756 3:110202809-110202831 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
962217725 3:133537124-133537146 TATTATTTTCATCAGGTGGATGG - Intergenic
962384828 3:134924114-134924136 TAATTTCTGCATAAGGTGGAAGG - Intronic
962640511 3:137380734-137380756 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
962914227 3:139884290-139884312 TAATATTTGTATAAGGTGTAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964788601 3:160428184-160428206 AAGTACTTGCATAATTTGGAAGG - Intronic
964902345 3:161674796-161674818 TAGTAATTCCATAAGGGGAATGG + Intergenic
965247215 3:166288485-166288507 TACTACATGCTTAAGGAGGAAGG + Intergenic
966478176 3:180374406-180374428 TAATTTTTGCATAAGGTGTAAGG - Intergenic
967403329 3:189087673-189087695 TAGTTTTTGTATAAGGTGTAAGG + Intronic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
967631491 3:191747498-191747520 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
968695411 4:2023159-2023181 TAGTTTTTGTATAAGGTGAAAGG - Intronic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
970738492 4:19203292-19203314 TAATTTTTGCATAAGGTGTAAGG - Intergenic
971443099 4:26711191-26711213 TAATTTTTGCATAAGGTGTAAGG + Intronic
971492227 4:27225269-27225291 TTGTACTTCCATAAAATGGAAGG + Intergenic
972115946 4:35633997-35634019 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
972867064 4:43245782-43245804 TAATATTTGCATATGGTGAAAGG - Intergenic
972973212 4:44602888-44602910 TAATTTTTGCATAAGGTGTATGG + Intergenic
973028481 4:45304554-45304576 TAATTTTTGCATAAGGTGTAAGG + Intergenic
973081428 4:45998482-45998504 TAATTTTTGCATAAGGTGTAAGG + Intergenic
973585096 4:52382599-52382621 TAATTTTTGTATAAGGTGGAAGG - Intergenic
973596855 4:52500556-52500578 TAATTTTTGCATAAGGTGTAAGG + Intergenic
974123190 4:57664444-57664466 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
974349870 4:60731168-60731190 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
974826981 4:67143893-67143915 TAATTTTTGCATAAGGTGTAAGG - Intergenic
975427418 4:74246645-74246667 TAATATTTGTATAAGGTGTAAGG + Intronic
975703370 4:77088069-77088091 TAATTTTTGCATAAGGTGTAAGG - Intergenic
976554946 4:86439450-86439472 TGGTACATCCATAAAGTGGAAGG - Intronic
976580087 4:86725985-86726007 TAATTTTTGTATAAGGTGGAAGG + Intronic
976739683 4:88345346-88345368 AAGTACATGCATCAGGTGTAAGG + Intergenic
977456831 4:97272111-97272133 TAATTTTTGCATAAGGTGTAAGG + Intronic
979042563 4:115816634-115816656 TAATATTTGTATAAGGTGTAAGG - Intergenic
979423177 4:120531548-120531570 TAATTTTTGCATAAGGTGTAAGG + Intergenic
979520516 4:121661166-121661188 TAATTTTTGCATAAGGTGTAAGG + Intergenic
980260140 4:130437995-130438017 TAGTTTTTGCATATGGTGTAAGG + Intergenic
980855552 4:138435095-138435117 TAATTTTTGCATAAGGTGTAAGG - Intergenic
980865325 4:138547472-138547494 TAATTTTTGCATAAGGTGTAAGG - Intergenic
981029953 4:140114165-140114187 TTCTACTTTCATAGGGTGGAGGG - Intronic
981263117 4:142746846-142746868 TAATTTTTGCATAAGGTGTAAGG - Intronic
981357141 4:143802394-143802416 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
981378481 4:144043260-144043282 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
981631431 4:146823270-146823292 TAGTTTTTGTATAAGGTGTAAGG + Intronic
981984271 4:150834971-150834993 TAATGCTTGTATAAGGTGTAAGG + Intronic
982905928 4:161070625-161070647 TTGTACTTGCGGAAGGTTGAAGG - Intergenic
983050868 4:163046044-163046066 TCGTATTTGGAAAAGGTGGAGGG - Intergenic
983291787 4:165816263-165816285 TAATATTTGTATAAGGTGTAAGG - Intergenic
983704806 4:170644230-170644252 TAATTCTTGTATAAGGTGTAAGG - Intergenic
983879510 4:172917222-172917244 TAATATTTGTATAAGGTGTAAGG - Intronic
983895762 4:173079976-173079998 TAATTTTTGTATAAGGTGGAAGG + Intergenic
983978318 4:173964107-173964129 TAATACTTGTATAAGGTGTAAGG + Intergenic
984843253 4:184087935-184087957 TAATTTTTGCATAAGGTGTAAGG - Intergenic
985134201 4:186768903-186768925 TAATTTTTGCATAAGGTGTAAGG - Intergenic
987108131 5:14660935-14660957 TAGGAATTTCATGAGGTGGAGGG + Intergenic
988186742 5:27873786-27873808 TAATTTTTGTATAAGGTGGAAGG - Intergenic
988402553 5:30780364-30780386 TAATTTTTGCATAAGGTGTAAGG - Intergenic
988815390 5:34829606-34829628 CAGTGCTAGCATAAAGTGGAGGG + Intronic
988944751 5:36185419-36185441 TAATATTTGTATAAGGTGTAAGG + Intergenic
989364375 5:40639237-40639259 TAATATTTGTATAAGGTGTAAGG - Intergenic
989683773 5:44061056-44061078 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
989955061 5:50348924-50348946 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
990656956 5:57967789-57967811 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
992288375 5:75259289-75259311 TAATTTTTGCATAAGGTGTAAGG - Intergenic
993821160 5:92618632-92618654 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
994142407 5:96356499-96356521 TAATTTTTGCATAAGGTGTAAGG + Intergenic
995270419 5:110214035-110214057 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
995272479 5:110237286-110237308 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
995413654 5:111885796-111885818 TAATTTTTGTATAAGGTGGAAGG - Intronic
995567145 5:113442665-113442687 TAATTTTTGCATAAGGTGTAAGG + Intronic
996055491 5:118978199-118978221 TAGTTTTTGTATAAGGTGTAAGG - Intronic
997052018 5:130393817-130393839 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
997095184 5:130902484-130902506 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
997097885 5:130934026-130934048 TAATTTTTGCATAAGGTGTAAGG - Intergenic
998686633 5:144534561-144534583 TAATTCTTGCATAAGTTGTAAGG - Intergenic
998704067 5:144738619-144738641 TAATTTTTGCATAAGGTGTAAGG - Intergenic
999063180 5:148656827-148656849 TAGGACTGGCATCATGTGGAGGG - Intronic
999078778 5:148823773-148823795 TAATTCTTGTATAAGGTGTAAGG + Intergenic
999086040 5:148890948-148890970 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1000421109 5:161038870-161038892 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1000449058 5:161361942-161361964 TAATTTTTGCATAAGGTGTAAGG + Intronic
1000480625 5:161769071-161769093 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1000596110 5:163216941-163216963 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1000704291 5:164491477-164491499 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1001167151 5:169379861-169379883 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1001372178 5:171216072-171216094 TAATTTTTGCATAAGGTGTAAGG + Intronic
1003510634 6:6776998-6777020 TAATACATGAAAAAGGTGGAAGG - Intergenic
1004181949 6:13388587-13388609 TAATTTTTGCATAAGGTGTAAGG - Intronic
1004289877 6:14356903-14356925 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1004641827 6:17523079-17523101 TAGGAATTGCATAAGATAGATGG + Intronic
1005240298 6:23817646-23817668 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1005656557 6:27944501-27944523 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1005737851 6:28765591-28765613 TAGTACTTGGATAGACTGGATGG + Intergenic
1006586252 6:35115844-35115866 TAGTATTTGTATATGGTGTAAGG - Intergenic
1008122791 6:47636801-47636823 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1008298877 6:49809703-49809725 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1008725008 6:54406988-54407010 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1008732594 6:54500819-54500841 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1008873672 6:56302896-56302918 TAATTTTTGCATAAGGTGTAAGG + Intronic
1008896575 6:56563746-56563768 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1009061101 6:58398757-58398779 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1009775111 6:68195631-68195653 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1010000292 6:70942047-70942069 TAGGCCTTGGATAAGGTGGGTGG - Intronic
1010421698 6:75683563-75683585 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1010493592 6:76504402-76504424 TATTTTTTGCATAAGGTGTAAGG + Intergenic
1010620730 6:78070908-78070930 TAATATTTGTATAAGGTGTAAGG - Intergenic
1011120551 6:83947380-83947402 TAATTTTTGCATAAGGTGTAAGG - Intronic
1011802086 6:91028537-91028559 TAATACTGGCATAAAGTGGATGG + Intergenic
1012060395 6:94471340-94471362 TAGTACTAGAATAAGGAGGAGGG - Intergenic
1012082619 6:94780612-94780634 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1012361715 6:98390539-98390561 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1012686450 6:102256500-102256522 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1013267845 6:108517477-108517499 TAATTTTTGCATAAGGTGTAAGG - Intronic
1013930168 6:115521067-115521089 TAGTTTTTGTATAAGGTGAAAGG - Intergenic
1014013736 6:116505842-116505864 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1014036782 6:116775921-116775943 TAATATTTGTATAAGGTGTAAGG + Intergenic
1014134642 6:117874385-117874407 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1014176533 6:118337412-118337434 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1014327965 6:120023342-120023364 TAATTCTTGTATAAGGTGTAAGG + Intergenic
1014850208 6:126331559-126331581 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1015494684 6:133867513-133867535 CAGTTCTTGGATATGGTGGATGG + Intergenic
1016436412 6:144042340-144042362 TAATTTTTGCATAAGGTGAAAGG + Intronic
1016486380 6:144544127-144544149 TACAACTTCCATTAGGTGGATGG + Intronic
1016789946 6:148057738-148057760 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1016828360 6:148408834-148408856 TAATATTTGCATATGGTGTAAGG + Intronic
1017058855 6:150461969-150461991 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1017440735 6:154462311-154462333 TAGTAGTTGCTTAGGGTTGAGGG - Intronic
1019113071 6:169733452-169733474 TACTTCTTGTATAAGGTGTAAGG + Intergenic
1020517559 7:9141756-9141778 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1020539416 7:9441352-9441374 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1020621570 7:10526192-10526214 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1020752964 7:12166050-12166072 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1021185793 7:17563271-17563293 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1021429239 7:20540784-20540806 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1023516380 7:41005851-41005873 GAGTACTTACACAAGGTTGAGGG - Intergenic
1024171666 7:46794067-46794089 TAGTACTTATATAAGATGAAAGG + Intergenic
1024452053 7:49558760-49558782 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1025572598 7:62595132-62595154 TAGTTCTTGTATAAGGTGTAAGG + Intergenic
1025862580 7:65345535-65345557 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1028633339 7:92960226-92960248 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1028643334 7:93068660-93068682 TAATATTTGTATAAGGTGGAAGG + Intergenic
1028834837 7:95363534-95363556 TTGTACTTTCATAAGGGGCAGGG + Intronic
1029903232 7:104064394-104064416 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1030760723 7:113346959-113346981 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1030791718 7:113738571-113738593 AGGTACCTGCATAAGGTGTAAGG + Intergenic
1031397476 7:121290969-121290991 TAATTCTTGTATAAGGTGTAAGG + Intronic
1031399516 7:121314914-121314936 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1031847786 7:126826881-126826903 TAATTTTTGCATAAGGTGTAAGG + Intronic
1032670712 7:134079987-134080009 TATTAATAGCATAAGCTGGATGG - Intergenic
1032955774 7:136970389-136970411 TAGTATTTGAATAAATTGGACGG - Intronic
1033293018 7:140104473-140104495 TAATTTTTGCATAAGGTGTAAGG + Intronic
1033626579 7:143116273-143116295 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1037029895 8:14091984-14092006 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1037641442 8:20747609-20747631 TAATGTTTGTATAAGGTGGAAGG - Intergenic
1038855508 8:31327480-31327502 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1040702930 8:50089230-50089252 TAATTCTTGTATAAGGTGTAAGG - Intronic
1040749469 8:50688423-50688445 TAATTCTTGTATAAGGTGTAAGG + Intronic
1040763371 8:50876834-50876856 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1041587436 8:59537804-59537826 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1042253646 8:66781322-66781344 TACTACTAGGATAAGGAGGAAGG - Intronic
1042322220 8:67488219-67488241 TAATTTTTGCATAAGGTGTAAGG + Intronic
1042479267 8:69285159-69285181 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1042626676 8:70765772-70765794 TAATCTTTGCATAAGGTGTAAGG + Intronic
1042854748 8:73254942-73254964 TAATTTTTGCATAAGGTGTAAGG - Intronic
1044090841 8:87998785-87998807 GAGTATTTGTATAAGGTGGTTGG - Intergenic
1044131378 8:88527993-88528015 TAATATTTGTATAAGGTGTAAGG - Intergenic
1044349953 8:91152295-91152317 TAATTTTTGCATAAGGTGTAAGG + Intronic
1044355801 8:91221538-91221560 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1045948501 8:107825253-107825275 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1046696812 8:117350170-117350192 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1046944084 8:119958486-119958508 TAGAAGTTGCATAACGTGGCCGG + Intronic
1047054477 8:121148830-121148852 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1047931987 8:129737636-129737658 TAATGTTTGTATAAGGTGGAAGG - Intergenic
1048546648 8:135393767-135393789 TAATACTTTCACCAGGTGGAGGG + Intergenic
1050129705 9:2398891-2398913 TAATATTTGTATAAGGTGTAAGG + Intergenic
1050215414 9:3317343-3317365 TAATTTTTGCATAAGGTGTAAGG - Intronic
1050217217 9:3340227-3340249 TAATTTTTGCATAAGGTGTAAGG - Intronic
1050673920 9:8030182-8030204 TAGTTCTTTCATATTGTGGATGG - Intergenic
1050780252 9:9324858-9324880 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1051886441 9:21898206-21898228 TAATTTTTGCATAAGGTGTAAGG - Intronic
1051946564 9:22576419-22576441 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1051985836 9:23085919-23085941 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1052321669 9:27174017-27174039 TACTACTTGCATAAGGTCCACGG - Intronic
1052451502 9:28636988-28637010 TAATATTTGTATAAGGTGTAAGG + Intronic
1052611836 9:30786218-30786240 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1052628761 9:31009716-31009738 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1052667564 9:31514553-31514575 TAATTCTTGTATAAGGTGTAAGG + Intergenic
1054997808 9:71412072-71412094 TAATTTTTGCATAAGGTGTAAGG - Intronic
1055061918 9:72077787-72077809 TAATATTTGTATAAGGTGTAAGG - Intergenic
1055069625 9:72152957-72152979 TAATTTTTGCATAAGGTGTAAGG + Intronic
1055226679 9:74005552-74005574 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1058145956 9:101411912-101411934 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1058599124 9:106650567-106650589 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1058754140 9:108068697-108068719 TAATTCTTGTATAAGGTGTAAGG + Intergenic
1058827257 9:108786201-108786223 TAGAATTTGCATAAGGTGGGTGG - Intergenic
1061849986 9:133408908-133408930 TGTTACTTGCAAAAGGTGGCGGG - Intronic
1203753994 Un_GL000218v1:106841-106863 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1186128180 X:6438473-6438495 TAGTAGTTGCCTAAGGTTGTGGG + Intergenic
1186442258 X:9596484-9596506 TAGTACTGGCATCTGGTGGGTGG + Intronic
1186535110 X:10339059-10339081 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1186869519 X:13756841-13756863 TTGTACTTGTATAAGGTAGGGGG + Intronic
1187453676 X:19422004-19422026 TAATTTTTGCATAAGGTGTAAGG - Intronic
1187472700 X:19582975-19582997 TAGTAATTGCATGCAGTGGAAGG - Intronic
1187622164 X:21068784-21068806 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1188110121 X:26187311-26187333 TTGTACTTTTCTAAGGTGGAAGG - Intergenic
1188826870 X:34846036-34846058 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1188986167 X:36770202-36770224 TAGGACCTGCAGAAGGTAGATGG - Intergenic
1189501720 X:41567062-41567084 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1189572273 X:42310979-42311001 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1190190660 X:48274436-48274458 TACTACCTGCATGAGGTGGTAGG + Intronic
1190576193 X:51841602-51841624 TAGTTTTTGTATAAGGTGTAAGG + Intronic
1190684507 X:52859416-52859438 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1190749697 X:53351045-53351067 TAATATTTGCAAAAGGTGTAAGG - Intergenic
1191091263 X:56624905-56624927 TAGTTTTTGTATAAGGTGTATGG - Intergenic
1191156402 X:57278402-57278424 TAGTTCTTCTATAAGGTGTAAGG - Intergenic
1191170290 X:57439768-57439790 TAATTTTTGCATAAGGTGTAAGG + Intronic
1191803213 X:65104243-65104265 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1191809083 X:65167209-65167231 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1191973393 X:66842778-66842800 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1192850700 X:74953172-74953194 TAATATTTGTATAAGGTGTAAGG + Intergenic
1193181826 X:78467391-78467413 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1193362912 X:80597148-80597170 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1193632739 X:83909992-83910014 TACTTCTTGTATAAGGTGTAAGG - Intergenic
1195113556 X:101671873-101671895 TAGAATTTACAAAAGGTGGATGG - Intergenic
1195932420 X:110091875-110091897 TAATTTTTGCATAAGGTGTAAGG + Intronic
1195993493 X:110707618-110707640 TAATTCTTGCATGAGGTGTAAGG - Intronic
1197087269 X:122493633-122493655 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1197285247 X:124587513-124587535 TAGTTTTTGTATAAGGTGTAAGG - Intronic
1197395161 X:125918535-125918557 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1197405269 X:126040954-126040976 TAGTTTTTGTATAAGGTGTAAGG + Intergenic
1197506454 X:127310764-127310786 TAGTTTTTGTATAAGGTGTAAGG - Intergenic
1197580913 X:128282637-128282659 TAGTAACAGCATAAGCTGGATGG - Intergenic
1198063067 X:133066697-133066719 TAATTTTTGCATAAGGTGGAAGG - Intronic
1198328722 X:135601357-135601379 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1198571739 X:137964643-137964665 TAATTTTTGTATAAGGTGGAAGG - Intergenic
1198582263 X:138078370-138078392 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1198785755 X:140285888-140285910 TAATTTTTGCATAAGGTGTAAGG + Intergenic
1200723246 Y:6631614-6631636 TAATTTTTGCATAAGGTGTAAGG - Intergenic
1201013659 Y:9575592-9575614 TAATTCTTGTATAAGGTGTAAGG - Intergenic
1201392713 Y:13515597-13515619 TAATCTTTGCATAAGGTGTAAGG + Intergenic
1201527953 Y:14957717-14957739 TAATTCTTGTATAAGGTGTAAGG - Intergenic
1201709045 Y:16969327-16969349 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1201930116 Y:19335212-19335234 TAATTTTTGTATAAGGTGGAAGG + Intergenic
1202378650 Y:24258872-24258894 TAGTCCTCGCATCAGGTGCAAGG - Intergenic
1202492132 Y:25411249-25411271 TAGTCCTCGCATCAGGTGCAAGG + Intergenic