ID: 1064669230

View in Genome Browser
Species Human (GRCh38)
Location 10:17692168-17692190
Sequence CAGATCTACCACTTTCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 2, 2: 11, 3: 57, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064669230 Original CRISPR CAGATCTACCACTTTCTAGC TGG (reversed) Intronic
901138409 1:7012340-7012362 CAGATCTGCCACTTTCTTTCTGG + Intronic
901189933 1:7403725-7403747 CAGATCAACCAGGTTCTAGATGG - Intronic
902321487 1:15670311-15670333 CAGCTCTATCACTGTCTATCGGG - Intergenic
902395084 1:16128196-16128218 CGCATCTGCCACTTCCTAGCGGG - Intronic
903777394 1:25801283-25801305 CAGCTCTGACACTTTGTAGCTGG + Intronic
903894024 1:26590940-26590962 CAGCTCTACCACTTTCTAAAAGG - Intergenic
904883491 1:33718120-33718142 TAGCTCTACCACATACTAGCTGG - Intronic
905751555 1:40469171-40469193 CAGATCTGCCATTTACTACCTGG - Intergenic
906075752 1:43050734-43050756 CAGCTCTACCATTTTTTAGTTGG + Intergenic
906672768 1:47668718-47668740 TAGCTCTACCACATTCTAGCTGG - Intergenic
906890898 1:49712775-49712797 CAGCTCTACCACTTAGTATCTGG + Intronic
907400276 1:54221029-54221051 CAGATCCTCCACTTCCTCGCTGG + Intronic
907862375 1:58365939-58365961 CAGATCACTCACTGTCTAGCGGG + Intronic
907990897 1:59581788-59581810 CAGGTCTGCTACTTACTAGCTGG - Intronic
908440191 1:64145920-64145942 CAGACCTTCCATTTACTAGCTGG - Intronic
908519425 1:64926778-64926800 CAGCTCTACCACGTGCCAGCTGG + Intronic
910225927 1:84936052-84936074 CATCTCTGCCACTTTCTAGCTGG + Intronic
911037857 1:93569299-93569321 CAGCTCTACCACATACCAGCTGG - Intronic
911626862 1:100133619-100133641 CTAAACTACCACTTTCCAGCAGG - Intronic
911725110 1:101235139-101235161 CAGCTCTGCCACTCACTAGCTGG + Intergenic
912746240 1:112247945-112247967 CAGATCACCCACTTATTAGCTGG - Intergenic
912756744 1:112330575-112330597 CCGTCCCACCACTTTCTAGCTGG - Intergenic
913205172 1:116532191-116532213 AAGATGTGCCACTTCCTAGCAGG - Intronic
915656979 1:157368766-157368788 CAGCTCTGTCACTTTCTAACTGG + Intergenic
915672005 1:157497496-157497518 CAGTTCTGTCACTTTCTAACTGG - Intergenic
916578477 1:166087666-166087688 CAGCTCTGCCACTTACAAGCTGG - Intronic
916825276 1:168436541-168436563 CAGCTCTGCTGCTTTCTAGCAGG - Intergenic
919607656 1:199705808-199705830 CAGATCTACCCCATCATAGCTGG - Intergenic
920720193 1:208380001-208380023 CAGTTCTAACACTGTCTACCTGG - Intergenic
920730702 1:208481271-208481293 CTGCTCTACCACTTACCAGCTGG - Intergenic
920903213 1:210133143-210133165 CAGTTATACCCCTTTCTAGGAGG + Intronic
921467204 1:215503128-215503150 GAGATCTACCCCTTTAAAGCTGG + Intergenic
922096025 1:222443417-222443439 CAGCTCCACCACTTGCTAGCTGG + Intergenic
922137261 1:222841454-222841476 CAGCTCTGACACTTACTAGCAGG - Intergenic
922931288 1:229391649-229391671 CAGCTCTGCCACTTACTTGCTGG + Intergenic
923801259 1:237211501-237211523 CAGCTGTACCACGTACTAGCTGG - Intronic
923805170 1:237249611-237249633 CAAATCTCTCACTTTCTAGATGG - Intronic
924422407 1:243921971-243921993 TAGCTCTACCACTTCCTAGCAGG - Intergenic
924747109 1:246846506-246846528 CATTTCTGCCACTTACTAGCTGG - Intronic
1063705330 10:8424876-8424898 CAGATTTAACATTTTCTTGCTGG + Intergenic
1064147793 10:12839365-12839387 CAGATCTAAATCTTTCTAGTGGG + Intergenic
1064669230 10:17692168-17692190 CAGATCTACCACTTTCTAGCTGG - Intronic
1064932879 10:20646765-20646787 CAGATATAAGATTTTCTAGCAGG + Intergenic
1065937434 10:30533054-30533076 CAGAGCTACTGCTTCCTAGCTGG + Intergenic
1067242303 10:44507283-44507305 CAGGTCTACCATTTGCCAGCTGG - Intergenic
1067344931 10:45430215-45430237 CAGTTCAGCCACTTGCTAGCAGG + Intronic
1068051309 10:51952401-51952423 GAGCTCTACTACTTACTAGCTGG + Intronic
1069079629 10:64074596-64074618 CAGCTCTGCCACATGCTAGCTGG + Intergenic
1072780790 10:98250122-98250144 CAGTCCCACCACTTTCTAGCTGG - Intronic
1073488501 10:103837330-103837352 TAGCTCTACCACTTGCTAGCAGG + Intronic
1073759716 10:106616407-106616429 CAGCTGCACCACTTGCTAGCTGG + Intronic
1073811438 10:107156300-107156322 CAGCTCTGCCACCTGCTAGCTGG + Intronic
1073987167 10:109222888-109222910 CACCTCTACCACTTTGTAACTGG - Intergenic
1074145491 10:110713804-110713826 CAGACTTGCCACTTACTAGCTGG - Intronic
1074983729 10:118639818-118639840 CACCTCCACCACTTCCTAGCTGG - Intergenic
1075497557 10:122938348-122938370 CAGTTCTGCCACTTACTGGCTGG - Intronic
1077508847 11:2944873-2944895 AAGATGTGCCACTTCCTAGCAGG - Exonic
1077843733 11:6002376-6002398 CAGCTCTACCAGTTTGTGGCAGG - Exonic
1078328089 11:10396756-10396778 CAGGTCTGCCACTTTGAAGCTGG - Intronic
1078581181 11:12540861-12540883 CAGTTCTACCCCTTTCTACAGGG - Intergenic
1078745431 11:14109411-14109433 CAGCTGTACCACTTTACAGCTGG - Intronic
1081793912 11:45806731-45806753 CAGCTCTGCCACTTATTAGCTGG - Intronic
1081810841 11:45913402-45913424 TAGCTCTACCACTGGCTAGCTGG + Intronic
1081862727 11:46342750-46342772 CACTTCTACCACTTACCAGCTGG + Intronic
1082006206 11:47420547-47420569 CAGCTCCACCACTGGCTAGCTGG + Intronic
1082779715 11:57277587-57277609 CAGTTCTGCCACCTGCTAGCTGG + Intergenic
1083735862 11:64680534-64680556 CAACTCTACCACTTCCTAACTGG + Intronic
1084182807 11:67455128-67455150 CAGATCTGCTACTTATTAGCTGG - Intronic
1084930097 11:72548336-72548358 CAGCTCTGCCTCTTTCCAGCTGG + Intergenic
1085193424 11:74649354-74649376 CAGCTCTACCATGTACTAGCTGG - Intronic
1085265705 11:75236741-75236763 CACCCCTACCACTTTCTAGTCGG + Intergenic
1085771797 11:79332158-79332180 CAGCTCTGCTGCTTTCTAGCTGG - Intronic
1086006316 11:82042380-82042402 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1086387847 11:86327697-86327719 TAGATCTACCGCTTTCAAACAGG + Intronic
1087094158 11:94304584-94304606 CAGCTCTGCTACTTACTAGCTGG - Intergenic
1089275254 11:117330915-117330937 CAGCTCTGCCTCTTACTAGCTGG - Intronic
1089410075 11:118233627-118233649 CAGTTCTTCCACTCACTAGCTGG + Intronic
1089947139 11:122487671-122487693 CAGCTCTGCCACTTACTAGCTGG - Intergenic
1090821072 11:130342320-130342342 CAGCTCTGCCATTTTCTAGTTGG - Intergenic
1091197146 11:133741056-133741078 CAGATCTCCCAGTTTCTGCCGGG + Intergenic
1091392378 12:133486-133508 CAGATCTGCCTCTTCCTTGCTGG + Intronic
1091913564 12:4251130-4251152 CAGCTCTGTCACTTACTAGCTGG + Intergenic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1094019908 12:25903168-25903190 AAAATTTACCACTTTCTACCAGG + Intergenic
1095201898 12:39394682-39394704 CAGATCTACCACTTTTTGTCAGG + Intronic
1095716160 12:45348934-45348956 CTGCCCTGCCACTTTCTAGCTGG + Intronic
1097008627 12:55936745-55936767 CGGATCTACCACAGTCTAACTGG + Intronic
1097023359 12:56036077-56036099 CAGATCTATCACATCCTAGAGGG - Exonic
1098205453 12:68104560-68104582 CAGCTCCACCACTTCCTAGCTGG - Intergenic
1098448422 12:70591369-70591391 TAGCTCTACCACTTACTGGCTGG + Intronic
1100939425 12:99709576-99709598 TAGCTATACCACTTGCTAGCTGG - Intronic
1101598381 12:106187874-106187896 CTGGTATACCCCTTTCTAGCTGG - Intergenic
1101707583 12:107234949-107234971 TAGTTCTACCACTTGCTAACAGG + Intergenic
1101751385 12:107585458-107585480 TAGGTCTGCCGCTTTCTAGCAGG + Intronic
1101795171 12:107966410-107966432 CAGATTTGCCACTTATTAGCTGG + Intergenic
1102005815 12:109588567-109588589 CAGCTCTCCCACTTGCCAGCTGG + Intronic
1102192766 12:111001547-111001569 CAGCTCTGCCACTTGCTAGCTGG + Intergenic
1102783853 12:115588045-115588067 CAAGCCTACCACTTGCTAGCTGG - Intergenic
1103360800 12:120352465-120352487 CAGCTCTGCCACTTCCTAGTTGG + Intronic
1104023596 12:125010303-125010325 CAGCTCTGCCTCTTACTAGCTGG - Intronic
1104431904 12:128723503-128723525 CAACTCTACCCCTCTCTAGCAGG - Intergenic
1107283842 13:38767062-38767084 CAGCTCTGCCCCTTACTAGCTGG - Intronic
1107824757 13:44318471-44318493 CAGATCTGCCACTAATTAGCTGG + Intergenic
1107986317 13:45779570-45779592 CAGCTCTGCCATTTGCTAGCTGG + Exonic
1108582662 13:51840115-51840137 CAGTTCTACCACTTACTAGCTGG - Intergenic
1111725015 13:91996245-91996267 CTGATCTAACACTTTCCTGCAGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112423593 13:99276219-99276241 CAGTTCTGACACTTTCTACCTGG + Intronic
1116715360 14:48419233-48419255 CAGCTCCACCACATTCTAGAAGG - Intergenic
1117149722 14:52873192-52873214 CACATCTATCACTAACTAGCAGG + Intronic
1117323515 14:54647378-54647400 CTGTTCTGCCACTTACTAGCCGG - Intronic
1118178594 14:63467905-63467927 CAGCTTTGCCACTTCCTAGCTGG + Intronic
1119420302 14:74504148-74504170 CAGCTCTGCCACTTACTAGGTGG + Intronic
1119545865 14:75471020-75471042 CAGCTCTATCCCTTGCTAGCTGG - Intronic
1119891762 14:78188123-78188145 CGGATGTAACACTTACTAGCTGG - Intergenic
1120191908 14:81447242-81447264 CAGCTCTGCCAGCTTCTAGCTGG + Intergenic
1121676265 14:95755493-95755515 CAGGTCTGCCACTCACTAGCTGG - Intergenic
1122014696 14:98784833-98784855 TAGGTCTACCACTTGCTAGTGGG + Intergenic
1126191083 15:45879496-45879518 AAGCTCTACTACTTACTAGCTGG - Intergenic
1126229623 15:46309787-46309809 CAGCTCTGCCAGTTACTAGCAGG - Intergenic
1126665279 15:51070571-51070593 CAGCTCTGCCACTTTCTAAATGG - Intronic
1127029346 15:54844832-54844854 CAGTTCTAACACTGTCTACCTGG + Intergenic
1127726760 15:61757815-61757837 CACTTCAGCCACTTTCTAGCTGG + Intergenic
1127965907 15:63922836-63922858 CAGAGCTCCCACTCTCCAGCTGG + Intronic
1128111238 15:65077474-65077496 CAGCTCTACCACCTCCTTGCTGG - Exonic
1128618955 15:69132663-69132685 CAGTTCTACCATTTACTTGCTGG - Intergenic
1129134971 15:73540391-73540413 CAAATATACAACTTTCTAACAGG + Intronic
1129294105 15:74590324-74590346 CAGCTCTACCACTTACTGGCTGG - Intronic
1129589618 15:76904197-76904219 CAGATTTACCACTCACCAGCTGG + Intronic
1129743810 15:78004010-78004032 CAGCTCTACCACTTACTAGCTGG + Intronic
1129767230 15:78178051-78178073 CAGCTCTGCCATTTACTAGCTGG + Intronic
1130283618 15:82538207-82538229 CAACTCTGCCACTTACTAGCTGG + Intronic
1130909958 15:88264121-88264143 CAGCTCCAGCACTTTCTAGCTGG + Intergenic
1130964588 15:88687405-88687427 CAGCTCCATCACTTACTAGCTGG + Intergenic
1130993600 15:88891708-88891730 TAGCTCTGCCACTTCCTAGCTGG - Intronic
1131077377 15:89503837-89503859 CAGCCCTGCCACTTCCTAGCTGG + Intergenic
1131077635 15:89505759-89505781 CAGATCTGCCACCCTCTAGCTGG - Intergenic
1133788610 16:8991980-8992002 CAGCTCTCCCACTTACCAGCTGG - Intergenic
1133985154 16:10662745-10662767 CAGCTCTGCCATTTCCTAGCTGG + Intronic
1134147680 16:11779828-11779850 AAAATCTACCAATTTCTAGGTGG + Intronic
1134202689 16:12211972-12211994 CGGCTCTACTACTTTCTAGGTGG - Intronic
1134686518 16:16162618-16162640 CAGCTCTGCCACTTACCAGCTGG - Intronic
1135161998 16:20104685-20104707 CAGCTCTGCCCCTTTCTAGCTGG - Intergenic
1135242003 16:20815707-20815729 CAGCCCTACCACTTACTAGCTGG - Intronic
1135391728 16:22099416-22099438 CACATCTGCCACTTTCTAGCTGG + Intronic
1137920118 16:52478695-52478717 CAGCTCTACCACTTACAAGCTGG + Intronic
1138162371 16:54766480-54766502 CAGCTCTGCCACTTACTAGCTGG + Intergenic
1139318854 16:66096695-66096717 CAGATCTGCCTCATACTAGCTGG + Intergenic
1139957987 16:70702248-70702270 CAGATCTTGCACTCTCTTGCTGG + Intronic
1141189904 16:81816910-81816932 CGGTTCTGCCTCTTTCTAGCTGG + Intronic
1141519043 16:84565344-84565366 CAGCTCTGCCACTTTCTATCTGG + Intergenic
1141526460 16:84614912-84614934 CAACTCTGCCACTTTCTAGCTGG + Intronic
1141952260 16:87346640-87346662 ACGTTCTAGCACTTTCTAGCAGG + Intronic
1143349999 17:6280843-6280865 CAGACCTACTACCTTGTAGCAGG + Intergenic
1143621611 17:8084186-8084208 CAGTTCTTCCACTGACTAGCTGG - Intronic
1143872770 17:9969544-9969566 CACAGCAACCACTTTCTACCTGG + Intronic
1144179260 17:12736675-12736697 CTGCTCTGGCACTTTCTAGCTGG - Intronic
1144552210 17:16250811-16250833 CAGCTCTACCAGTTATTAGCTGG - Intronic
1146168147 17:30608193-30608215 CACATCTGCCACTCTCAAGCTGG - Intergenic
1146221115 17:31021674-31021696 CACATCTGCCACTCTCAAGCTGG - Intergenic
1146554454 17:33811771-33811793 CAGCTGTACCACTTCCCAGCAGG - Intronic
1149485295 17:57037894-57037916 CAGCTCTACCCCTTCCTGGCTGG + Intergenic
1149666375 17:58367572-58367594 CAGATCTAGCTCCTTCTAGCAGG + Intronic
1150366682 17:64593771-64593793 CACATCTGCCACTCTCAAGCTGG + Intronic
1150628658 17:66860220-66860242 CAGCTCCCCCAGTTTCTAGCTGG + Intronic
1150709289 17:67516323-67516345 CAGCTCTACTACTTACTACCTGG + Intronic
1150857505 17:68767439-68767461 CACCTCTGCCACTTACTAGCTGG - Intergenic
1151911774 17:77088293-77088315 CAGCTCTGCCACTTCCTGGCCGG + Intronic
1155986769 18:32238429-32238451 CAGCTCCAGCACTTACTAGCTGG - Intronic
1157804177 18:50645804-50645826 CAGTTCTGCCACTTTCCAGATGG + Intronic
1158057619 18:53300821-53300843 CAGATCTACCACAAATTAGCTGG - Intronic
1158721243 18:59926871-59926893 CAAATCCACCACTTAATAGCTGG + Intergenic
1159666531 18:71168182-71168204 CAGCTCCACAACTTGCTAGCTGG + Intergenic
1159841535 18:73404368-73404390 CAGTTGTACTACTTTCTGGCTGG + Intergenic
1161896764 19:7088296-7088318 GTGCTCTACCACTTACTAGCTGG - Intergenic
1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG + Intronic
1164806609 19:31121856-31121878 CAGCTTTACCACTTCCTAGCCGG + Intergenic
1165308404 19:35016109-35016131 CAGCTCTGCCACTTACTAGCTGG + Intronic
1165896737 19:39145915-39145937 CAGCTCCGCCACCTTCTAGCTGG + Intronic
1166522845 19:43492692-43492714 CAGCTCTGCCACATACTAGCTGG + Intronic
1166788979 19:45386275-45386297 CAGTTCTACCCCTGTCTAGATGG - Intronic
1167022797 19:46891077-46891099 CAGCTCTGCCACTTTCCATCTGG + Intergenic
925277860 2:2662995-2663017 CAGTTCAACCACTTTCTAGCTGG + Intergenic
926189218 2:10715274-10715296 CAGTTCTGCCACTTACTAGCTGG - Intergenic
926622639 2:15060681-15060703 TAGATCTACTACTTTCTCGTGGG + Intergenic
927010832 2:18902367-18902389 CAGTTCTGCCACTTATTAGCTGG - Intergenic
927494666 2:23544372-23544394 CTCCTCTGCCACTTTCTAGCTGG + Intronic
927580230 2:24237113-24237135 CACCTCTACCGCTTACTAGCAGG + Intronic
928087966 2:28357368-28357390 CAGCTCCGCCACTTCCTAGCTGG + Intergenic
928205364 2:29279838-29279860 GAGTTCTACCACTTACTAGCTGG + Intronic
928335981 2:30398606-30398628 CAACTCTGCCACTTACTAGCTGG + Intergenic
929761274 2:44809366-44809388 TAGTTCTGCCACTTTCTAGTTGG + Intergenic
930370739 2:50498104-50498126 GAGATGTATCACTTTCTAGTTGG - Intronic
932915249 2:75850790-75850812 CAGTTCTGCCACTTACTAGCTGG + Intergenic
933373674 2:81450613-81450635 CAGATCTATAACTTTCTATGAGG + Intergenic
934520480 2:95017200-95017222 AAGAACTACCACTTGCTAGGAGG + Intergenic
936505452 2:113102196-113102218 CAGATCATCCACTTGCTGGCTGG + Intergenic
938927158 2:136054678-136054700 CAGCTCTACCACTTACTAGCTGG - Intergenic
938953854 2:136281115-136281137 CATCTCTACCACTTTCTGGCTGG + Intergenic
939730507 2:145778681-145778703 CAGCTTTGCCACTTACTAGCTGG - Intergenic
941746141 2:169088676-169088698 CAGTTCTGCCACTTACCAGCTGG - Intronic
942335580 2:174881398-174881420 TGGATCTGCCACTTCCTAGCTGG + Intronic
942973770 2:181989667-181989689 CAGATCTCCCAATTACTAGATGG + Intronic
943329845 2:186545955-186545977 CAGCTCTACCACTTTCTAGTTGG - Intergenic
944291801 2:198016531-198016553 CAGCTCTGGCTCTTTCTAGCTGG + Intronic
944417049 2:199489370-199489392 CAGATCTCGAACTTTTTAGCAGG + Intergenic
944468958 2:200032729-200032751 CAGTTCTACCACTTACTGGCTGG - Intergenic
946113333 2:217439210-217439232 TAGCTCTACCATTTACTAGCTGG + Intronic
947159940 2:227204147-227204169 AAGATCCACCATTTACTAGCCGG + Intronic
947750832 2:232531156-232531178 CAGCTCTGCCACTTACTAGCTGG - Intronic
1168952541 20:1812282-1812304 CAGCTCTGACACTTACTAGCTGG + Intergenic
1168995865 20:2132801-2132823 CAGCTCTCCTACTTACTAGCTGG + Intronic
1169332296 20:4725472-4725494 TGGCTCTGCCACTTTCTAGCTGG - Exonic
1169385060 20:5141646-5141668 CTGATCTACCAGTTTCAAGCTGG - Intronic
1169553255 20:6723075-6723097 CAGGTCTGCCACTTTCTACTTGG - Intergenic
1169717783 20:8639750-8639772 CAATTCTACCATTTTCTAGCTGG - Intronic
1170087821 20:12555057-12555079 CAGATCTAGCTCTTTATACCTGG + Intergenic
1170276020 20:14589795-14589817 CAGATGTACCATTTTCCAGCTGG - Intronic
1170403719 20:16014228-16014250 CAGTTCTATCACTTTTTGGCTGG + Intronic
1170419540 20:16179177-16179199 TAGCTCTACTACTTCCTAGCTGG + Intergenic
1170917427 20:20641095-20641117 AAGCGCTGCCACTTTCTAGCTGG + Intronic
1172606589 20:36218171-36218193 CAGCTCTACCACTAACTTGCTGG + Intronic
1173594565 20:44250269-44250291 CAGCTCTACCACTGACCAGCTGG + Intronic
1173662375 20:44743662-44743684 CAGCTCCTCCACTTCCTAGCTGG - Intergenic
1174166071 20:48584401-48584423 CAGCTCCACCACTTCCTAGCTGG + Intergenic
1174200079 20:48801000-48801022 AAAATCTGCCACTTACTAGCTGG + Intronic
1174826874 20:53776493-53776515 CACCACCACCACTTTCTAGCTGG + Intergenic
1174846332 20:53947120-53947142 CAGACCTGCCACTTCCTAGCTGG + Intronic
1175173425 20:57094994-57095016 CAGCTCCACCACTTACTAGATGG + Intergenic
1175641599 20:60634960-60634982 CAGAACTGCCACTTTCTAACAGG + Intergenic
1177972459 21:27807572-27807594 CAGATCATCCACATTCAAGCTGG - Intergenic
1179669461 21:42936082-42936104 TAGATCGACTACTTGCTAGCAGG + Intergenic
1180669773 22:17543973-17543995 CAGCTCTGCTACTTACTAGCTGG - Intronic
1182289411 22:29266810-29266832 CACATCTACCAGTTTCCTGCAGG + Intronic
1182321869 22:29482853-29482875 CAGCTCTGCCACTCACTAGCTGG + Intronic
1183069673 22:35387293-35387315 CAGCACTGCCACTTACTAGCTGG + Intronic
1183104457 22:35606338-35606360 CAGCTCTGCCACTTACTAGCAGG + Intergenic
1184676698 22:46046879-46046901 CAGCGCTACCTCATTCTAGCTGG + Intergenic
1184804532 22:46784921-46784943 CAGCTCCAACACTTACTAGCTGG - Intronic
1185342459 22:50297752-50297774 CAGCTCTGTCACGTTCTAGCTGG + Intronic
949965330 3:9351150-9351172 CACATCTGCCACATTCTAGGGGG + Intronic
950638650 3:14333689-14333711 CAGCTCCACCACTTACCAGCTGG + Intergenic
950750404 3:15123769-15123791 CAGACACACCACGTTCTAGCGGG - Intergenic
953266458 3:41393903-41393925 CAGCTCTACCATTTCCTAGTTGG + Intronic
953822021 3:46215000-46215022 CAGACCTACCAGGTTCTAGTTGG - Intronic
954065176 3:48100151-48100173 CAGATCTACCACTTACTGGTTGG - Intergenic
954929479 3:54268772-54268794 CGGCTCTGCCACTTACTAGCTGG - Intronic
955514205 3:59710522-59710544 CAGCTCTACCTCTTACAAGCTGG + Intergenic
955884421 3:63582773-63582795 CGGTTCTACCACTTACTAGCTGG + Intronic
956119726 3:65954350-65954372 CAGAGCAACCCCGTTCTAGCTGG - Intronic
956959250 3:74379063-74379085 CAGTTCTACCATTTTCTTTCAGG + Intronic
959910979 3:111763356-111763378 CACCTCTACCACTTTCTAGCTGG + Intronic
960854303 3:122086955-122086977 CAGCTGTACCATTTACTAGCTGG + Intronic
961518566 3:127454043-127454065 CAGACTTGCCACTTTCCAGCTGG - Intergenic
962136410 3:132738948-132738970 CAGTTCTGCTATTTTCTAGCAGG + Intergenic
962611491 3:137080969-137080991 CAGCTCTACCACTTTCCAATTGG - Intergenic
962885240 3:139619115-139619137 CAGACCTACCACATGGTAGCAGG - Intronic
964348579 3:155780358-155780380 CAGCTCTGCCATTTACTAGCTGG + Intronic
964420323 3:156495621-156495643 CAGCTCCATCACTTACTAGCTGG + Intronic
964562852 3:158017564-158017586 CTGCTCTTCCACTTTCTAGCTGG - Intergenic
965671205 3:171149797-171149819 AAGATTGAACACTTTCTAGCTGG - Intronic
966556534 3:181267800-181267822 CAAAAGTACCACTATCTAGCTGG - Intergenic
966569306 3:181423376-181423398 CAGCTCTACCACTTACTAGCTGG + Intergenic
966846485 3:184134696-184134718 CAGTTCTTCCACTTACTAGCTGG + Intergenic
967241999 3:187448654-187448676 CAGAACCACCACTTCCTACCTGG - Intergenic
968868029 4:3226247-3226269 CAGCTCGGCCACTTCCTAGCAGG + Intronic
970858514 4:20675565-20675587 CAGCTCTGCCACTTCCTAGCTGG + Intergenic
971401003 4:26275309-26275331 CAGCTCTGCCACTTGCTGGCAGG + Intronic
971425319 4:26509931-26509953 CAGATCCACGTCTTTCTAACAGG + Intergenic
972452725 4:39219557-39219579 CAGTTCTATTACTTGCTAGCTGG + Intronic
972456640 4:39262147-39262169 CAGATCAATTACTTTCTATCTGG - Intronic
973676295 4:53267172-53267194 CATTTCCACCACTTTCTACCAGG - Intronic
973720332 4:53717442-53717464 TGGTTCTACCACTTGCTAGCTGG + Intronic
973817746 4:54633653-54633675 CAGATGTGCCACTAACTAGCTGG + Intergenic
977267993 4:94879171-94879193 CAGCTCTACCATTTACTTGCTGG - Intronic
978846969 4:113285297-113285319 CAGTTCTAACACTGTCTATCTGG + Intronic
983035209 4:162855884-162855906 GTGATCTGCCACGTTCTAGCAGG - Intergenic
984466906 4:180111157-180111179 CAGAACTACCACTCCCTGGCAGG + Intergenic
984665384 4:182421871-182421893 TAGATCTACCAGGTTCTTGCTGG + Intronic
986083298 5:4416353-4416375 CAGTTCTATCACATTCTATCGGG + Intergenic
988650089 5:33139565-33139587 CAGCTCTACAACTTACTACCTGG + Intergenic
990422254 5:55647941-55647963 CAGATATACCACATTTTGGCCGG + Intronic
990490548 5:56298967-56298989 CAGATTTTCCACTTACAAGCTGG + Intergenic
992025461 5:72665033-72665055 CAGCTCTGCCACTTTCTAGCTGG - Intergenic
994150401 5:96440979-96441001 CAGCTCTGCCACTTATTAGCTGG + Intergenic
994804320 5:104424267-104424289 CAGGTCCACCACTTTCCAACAGG + Intergenic
995026450 5:107429144-107429166 GAAATATACCACCTTCTAGCCGG + Intronic
997741118 5:136255830-136255852 CAGATCTCCTGCTTCCTAGCAGG - Intronic
998511185 5:142715412-142715434 CAGCTCTGCCAGTTGCTAGCTGG + Intergenic
998605680 5:143632427-143632449 CAGTTCTAACACTATCTATCTGG + Intergenic
999255729 5:150209195-150209217 CTGTTCTACCACTTGCAAGCTGG - Intronic
999420389 5:151436869-151436891 CAGCCCTGCCACTTACTAGCAGG - Intergenic
999580389 5:153031930-153031952 TAACTCTACCACTTACTAGCTGG - Intergenic
999870718 5:155747600-155747622 TAGCTCTACCACTTTGTAGCTGG - Intergenic
1000824170 5:166023497-166023519 CAGCTCTACCAATTACCAGCTGG - Intergenic
1001698177 5:173688152-173688174 CAGCTCTCCTACTTACTAGCTGG - Intergenic
1001926227 5:175639241-175639263 CAGCTCCATCACTTTCTAGCCGG - Intergenic
1002884126 6:1278832-1278854 CAGCTCTGCCACTTGCAAGCTGG - Intergenic
1003018355 6:2487412-2487434 CAGCTCTGACACTGTCTAGCTGG + Intergenic
1003526131 6:6899209-6899231 CAGCTCTGCCACATCCTAGCTGG + Intergenic
1003557188 6:7150690-7150712 CAGATCTGCCACTTGCTTCCTGG - Intronic
1004328383 6:14698581-14698603 CTGCTCTACCATTTGCTAGCTGG + Intergenic
1006192609 6:32218849-32218871 CAGCTCTGCCACTTGCTAGCTGG + Intronic
1006366353 6:33618421-33618443 CAGCTCTGCCACTTTCTAGCAGG - Intergenic
1006585962 6:35112953-35112975 AAAAACTATCACTTTCTAGCAGG - Intergenic
1007660330 6:43480920-43480942 CAGCTCTGTCACTTACTAGCTGG - Intronic
1007828976 6:44624003-44624025 CAGTTCTCCCTCTTTCTAGTTGG + Intergenic
1007895168 6:45348250-45348272 CAGTTCTACCACTGAATAGCTGG + Intronic
1008487613 6:52052813-52052835 CAGTTTTCCCACTTTCTTGCTGG - Intronic
1008718901 6:54324471-54324493 CAATTCTACCACTTTCTATTGGG + Intronic
1008883503 6:56406806-56406828 TAGATCCACCACGTACTAGCTGG + Intergenic
1008886277 6:56433666-56433688 CAGCTGTAGCACTTACTAGCTGG + Intergenic
1009942978 6:70310649-70310671 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1011322262 6:86108723-86108745 CTGTTCTCCCACTTTCTACCTGG - Intergenic
1013652467 6:112209581-112209603 TAGCTCTTCCACTTTCTAGCTGG + Intronic
1015031891 6:128604942-128604964 CAGACCTACCACACTGTAGCAGG - Intergenic
1015073196 6:129122782-129122804 AGGCTCTGCCACTTTCTAGCTGG + Intronic
1016041405 6:139435245-139435267 CAGTTGTACCACTTACCAGCTGG + Intergenic
1016553010 6:145302896-145302918 CAGATCTACCAGTTTATGCCGGG + Intergenic
1020517234 7:9138394-9138416 CAGTTGTATCACTTACTAGCTGG - Intergenic
1020760883 7:12267417-12267439 CTTATCTTGCACTTTCTAGCAGG + Intergenic
1021585456 7:22202791-22202813 TAGAGTTGCCACTTTCTAGCTGG + Intronic
1021862009 7:24915187-24915209 CAGATTAACAACTTTCCAGCAGG - Intronic
1022694509 7:32691186-32691208 CTGCTCTACCATTTACTAGCTGG - Intergenic
1022927689 7:35072698-35072720 CTGCTCTACCATTTACTAGCTGG - Intergenic
1024018058 7:45336623-45336645 CTTATCCACCACTTTCAAGCTGG + Intergenic
1024097098 7:45990923-45990945 CAGCTCTACCACTTTGGAGAGGG + Intergenic
1026321366 7:69270230-69270252 CAGATCTGCCACTGCCTACCTGG + Intergenic
1028374582 7:90132886-90132908 CTGCTCTACCATTTACTAGCTGG + Intergenic
1028573426 7:92318039-92318061 CAGTTCTACTGCTTACTAGCTGG + Intronic
1030645962 7:112062046-112062068 CTGCTCTGCCACTTACTAGCTGG - Intronic
1032739973 7:134729350-134729372 CAGCTCCACCATTTACTAGCTGG - Intergenic
1033209687 7:139451709-139451731 TAGACCTTCCACTTTCTAGCTGG + Intergenic
1034198475 7:149265888-149265910 CAGCTCTGCCACTTACAAGCTGG - Intronic
1035769930 8:2138916-2138938 CAGAACTCCCACTTTCTATCCGG + Intronic
1036063880 8:5356606-5356628 CAGCTCCACCCCTTACTAGCTGG + Intergenic
1038553039 8:28486161-28486183 CAGATATATCACTTTTTAGCTGG - Intronic
1039097568 8:33903257-33903279 CAGCTCTTCCACTTACTACCTGG - Intergenic
1039659286 8:39445833-39445855 CAGATGTACCAGTCTCTAGTAGG - Intergenic
1039697185 8:39925580-39925602 CAGCTCTGCCACTTTCTAGCTGG - Intronic
1040072009 8:43196104-43196126 CAGCTCTGCCACTTCCCAGCTGG + Intronic
1043443935 8:80300953-80300975 CAGATCTGGCACTTGCTTGCAGG + Intergenic
1044612011 8:94100919-94100941 CAGCTCCACCACTTACTAGCTGG - Intergenic
1045795046 8:106032656-106032678 CAGCTCTGCTATTTTCTAGCTGG + Intergenic
1046740274 8:117820279-117820301 CAGATCTACCACTTACTGGTCGG + Intronic
1048338937 8:133524295-133524317 TGGCTCTACCACTTTCTAGCTGG - Intronic
1048530001 8:135239291-135239313 CAAAACTGACACTTTCTAGCAGG - Intergenic
1049487735 8:142875235-142875257 CAGAACTACCACATCCCAGCTGG - Exonic
1049492507 8:142912808-142912830 CAGAACTACCACATCCCAGCTGG - Exonic
1051193240 9:14536051-14536073 CTGGTCTGCCACTTGCTAGCTGG + Intergenic
1051202714 9:14646560-14646582 CTCATCTACCACTTTCTTCCTGG + Intronic
1052035088 9:23671384-23671406 CGGAACTACCACTTACTACCTGG + Intergenic
1055730663 9:79276751-79276773 CAGCTTCACCACTTACTAGCAGG - Intergenic
1056217919 9:84422477-84422499 CATTTCTTCCACTTTCAAGCTGG - Intergenic
1057602913 9:96473906-96473928 CAGCTCTGCCACTTACTAGTTGG + Intronic
1058157958 9:101535951-101535973 GAGCTGTACCACTTCCTAGCTGG + Intronic
1059395917 9:114033990-114034012 CAGCTCCACCACTTACTAGCTGG + Intronic
1059588210 9:115629046-115629068 CACCTCTACCACTTACTAACTGG + Intergenic
1060269188 9:122128909-122128931 CAGCTCTGCCACTTTCTGGCTGG + Intergenic
1060386676 9:123236728-123236750 CAGCTCTTCAACTTTCTAGCTGG + Intronic
1060487330 9:124056342-124056364 TGGATCTACCACTTACTAGGTGG - Intergenic
1060545942 9:124458993-124459015 CAGCTCTGCCACTTACAAGCTGG - Intronic
1060972429 9:127746051-127746073 CAGCTGTACCACTTGCTGGCTGG - Intronic
1061360789 9:130141037-130141059 CAGCTCTGACACTTACTAGCTGG - Intergenic
1061518165 9:131101707-131101729 CAGATCTGCCACTTCCTGGCTGG - Intronic
1061933694 9:133846178-133846200 CACCTCTGCCACTTTCTGGCTGG - Intronic
1186840187 X:13477710-13477732 CAGCTCTACCACTCACTGGCTGG - Intergenic
1187099312 X:16176208-16176230 TTGGTCTACCACTTACTAGCTGG + Intergenic
1187368961 X:18688052-18688074 CAGCTCTGCCACTTTCAACCTGG - Intronic
1187871593 X:23769168-23769190 ACTATCTGCCACTTTCTAGCTGG + Intergenic
1187901341 X:24029252-24029274 CACATTTACCACATTCTAACAGG - Intergenic
1189884461 X:45526584-45526606 CAGATATAGCACTTTCTAAAAGG + Intergenic
1192226249 X:69230073-69230095 TAACTCTACCACTTACTAGCTGG - Intergenic
1196689508 X:118544327-118544349 TATTTCTACCACTTACTAGCTGG + Intronic
1197637957 X:128937426-128937448 CAGTTCTGCCACTTATTAGCTGG + Intergenic
1198029781 X:132743671-132743693 TGGCTCTACCACTTCCTAGCTGG - Intronic
1198742811 X:139858759-139858781 CAGCTCTATCACTTAGTAGCTGG - Intronic
1199835395 X:151585237-151585259 TTGATCTACTACTTACTAGCTGG + Intronic