ID: 1064669256

View in Genome Browser
Species Human (GRCh38)
Location 10:17692489-17692511
Sequence CTGGTAACTGGCAGAATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064669252_1064669256 13 Left 1064669252 10:17692453-17692475 CCGGTATAGAGACTGCTCAGGAA 0: 1
1: 0
2: 2
3: 10
4: 84
Right 1064669256 10:17692489-17692511 CTGGTAACTGGCAGAATGGTTGG No data
1064669250_1064669256 24 Left 1064669250 10:17692442-17692464 CCTGTAAAGTACCGGTATAGAGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1064669256 10:17692489-17692511 CTGGTAACTGGCAGAATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064669256 Original CRISPR CTGGTAACTGGCAGAATGGT TGG Intronic
No off target data available for this crispr