ID: 1064670579

View in Genome Browser
Species Human (GRCh38)
Location 10:17709725-17709747
Sequence CTGGGCAATCCTAACACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064670579 Original CRISPR CTGGGCAATCCTAACACTGC TGG (reversed) Intronic
904425304 1:30418986-30419008 CTGGGCAGACCTACCTCTGCAGG + Intergenic
916037628 1:160935171-160935193 CTGGCCAATCCTAGCACTTTGGG - Intergenic
917560707 1:176152029-176152051 CTGCAAAATCCTAGCACTGCGGG + Intronic
920274828 1:204796337-204796359 CTGGAGAATCCTAATACAGCAGG - Intergenic
922220346 1:223553454-223553476 CTGGGCAATCCTCACTCTGAAGG + Intronic
923446018 1:234072156-234072178 TAGGACAATCCTAACAGTGCTGG + Intronic
924776072 1:247115043-247115065 CTGGGAAACCCAAACCCTGCTGG - Intergenic
1062972900 10:1662128-1662150 CTGGGACATCCTCCCACTGCAGG - Intronic
1064589131 10:16870466-16870488 TAGGGCAATCCTACCAGTGCTGG - Intronic
1064670579 10:17709725-17709747 CTGGGCAATCCTAACACTGCTGG - Intronic
1067695477 10:48532233-48532255 CTGGGCAGTCTGAACACTGCTGG + Intronic
1069897030 10:71686347-71686369 CAGGGGAATCCTGAGACTGCTGG + Intronic
1070565824 10:77603261-77603283 CTGTGCAAGCCTGACTCTGCAGG - Intronic
1071157238 10:82705316-82705338 TTAGACAATGCTAACACTGCTGG + Intronic
1076882489 10:133246268-133246290 CTGGGCTCTCCCAACACTGCCGG + Intergenic
1077712051 11:4547182-4547204 TTGGGCAATTCTATCACTTCTGG - Intergenic
1080388776 11:31825862-31825884 CTGGGGGATCCTAGCCCTGCGGG - Intronic
1084169596 11:67394331-67394353 CTGGGCAGTCCGAGCACTGGGGG + Intronic
1084682242 11:70673195-70673217 CTGGGCAAACCTGTCGCTGCAGG - Intronic
1087232276 11:95679577-95679599 CTGGGAAATCCAAAATCTGCAGG - Intergenic
1090439985 11:126717411-126717433 CTGGGACATTCTATCACTGCTGG - Intronic
1090568483 11:128021632-128021654 CTGGGCTGCCCTCACACTGCAGG + Intergenic
1096919456 12:55068376-55068398 CTGGTCATTCCTGCCACTGCAGG - Intergenic
1099225065 12:79959647-79959669 CTGGGCTATCCCAACAAAGCAGG + Intergenic
1102555744 12:113725343-113725365 CTGGGCTGACCTGACACTGCTGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1110069890 13:71161605-71161627 CTGGGGAAACTTAAAACTGCAGG + Intergenic
1112361515 13:98723263-98723285 ATCGGCAATCCCCACACTGCTGG - Intronic
1113460585 13:110479451-110479473 CTGGGCAATTCTGCCTCTGCTGG - Intronic
1114355431 14:21903052-21903074 CTGAGCAATGGAAACACTGCAGG - Intergenic
1117993082 14:61453915-61453937 CTGTGCAATCCCAACACTTTGGG - Intronic
1118003647 14:61545894-61545916 CTGGGCAAGACAAACAGTGCAGG - Intronic
1119321731 14:73735895-73735917 CTCTGCAATCCTAACACTTTGGG + Intronic
1119439184 14:74616827-74616849 CTGGGCAAACCTTTCCCTGCTGG - Intergenic
1121963367 14:98281843-98281865 CTGGGCAAGTCTAGCACTGCAGG + Intergenic
1122116488 14:99530131-99530153 GTGGACACTCCTTACACTGCTGG + Intronic
1122763046 14:104044034-104044056 CTGGTCAATCCCACCACTGCAGG + Intronic
1123479060 15:20614319-20614341 CTGGGCAGTCCTCACTCTGCAGG + Intergenic
1123638952 15:22386066-22386088 CTGGGCAGTCCTCACTCTGCAGG - Intergenic
1125183757 15:36907525-36907547 CTGGTCCATCCAAACACTTCTGG - Intronic
1131174186 15:90199950-90199972 CTGGGCAATAGTAGCACTGTGGG + Intronic
1131207009 15:90458060-90458082 CTGGGCAACCATCAGACTGCTGG + Intronic
1134125524 16:11613430-11613452 CTGGGCAATTCAGACACAGCTGG + Intronic
1136281329 16:29213198-29213220 CCAGGCAATGCTTACACTGCGGG - Intergenic
1139916481 16:70431350-70431372 CTGAGCAGTCCTAGCCCTGCGGG - Intronic
1139965969 16:70745610-70745632 CAGGGAACTCCTCACACTGCAGG + Intronic
1140491968 16:75345064-75345086 CTGGGCAATCCCAGCACTTTGGG + Intronic
1142085698 16:88179126-88179148 CCAGGCAATGCTTACACTGCGGG - Intergenic
1142655270 17:1388218-1388240 CTGGCCAATCCTAGCACTTTGGG - Intronic
1145213379 17:21033145-21033167 CTGGGGAATCCTGCCTCTGCAGG - Intronic
1147935446 17:44008013-44008035 CTGAGGAATCCTAACCCTTCAGG + Intronic
1149172091 17:53823483-53823505 CTGGGAAATCCAGAAACTGCAGG + Exonic
1149366593 17:55951589-55951611 CTGGGGAATCCTCACAATGATGG - Intergenic
1149771387 17:59324588-59324610 CTGGGCAATCCCAGCACTTTGGG + Intergenic
1150517473 17:65828544-65828566 CTGGGCCATCCTAATACATCTGG + Intronic
1150881590 17:69035246-69035268 CTGGGCCATCCCAACAGTGAAGG + Exonic
1153931399 18:9882713-9882735 TTGGGCAATTATAAAACTGCTGG - Intergenic
1156530867 18:37813862-37813884 CTGGAGAATCCTAACACAGGAGG + Intergenic
1157531916 18:48428597-48428619 CTGGGCTCTGCTAACACAGCTGG - Intergenic
1158518938 18:58154247-58154269 CTGGGCAGTACTCACTCTGCAGG - Intronic
1160899260 19:1419056-1419078 GTGGGCCATCCTTCCACTGCCGG + Intronic
1162544476 19:11320416-11320438 CTGGCCAATCCTAGCACTTTGGG + Intronic
1162544980 19:11323830-11323852 CTTAGCCATCCTAACAGTGCTGG + Exonic
1165283331 19:34816307-34816329 CTGGGCAAACCTGTTACTGCTGG + Intergenic
1168414147 19:56158391-56158413 CTGTGCAATCCCATCCCTGCTGG - Intronic
926143209 2:10380824-10380846 CTGGGCACTTATCACACTGCGGG + Intronic
926931634 2:18046947-18046969 CTGGGCCACCCCAAAACTGCAGG - Intronic
926931870 2:18049003-18049025 CTGGGCCACCCCAAAACTGCAGG - Intronic
930029204 2:47048083-47048105 CTGGGCCAGCCCCACACTGCTGG + Intronic
932442215 2:71744683-71744705 CTGGGCATTTCAGACACTGCAGG + Intergenic
934591839 2:95560458-95560480 GTGGGAAATTCTCACACTGCAGG - Intergenic
937672122 2:124549164-124549186 CTGGGTAATCCAGGCACTGCTGG + Intronic
940913346 2:159228316-159228338 CTGAGCAAACCTAACACAGAAGG - Intronic
944744042 2:202637514-202637536 CTGGGCAATCCTAGCACTTTGGG - Intronic
946156637 2:217811205-217811227 CTGGGATATGCTGACACTGCCGG + Intronic
947016998 2:225632078-225632100 CCGGGCAATCCCAGCACTTCAGG - Intronic
947524001 2:230867532-230867554 CTGGGCATTCCCAACAGTACGGG - Intronic
948169440 2:235889282-235889304 CTGGGGAAACCTGACATTGCAGG + Intronic
1173241390 20:41300787-41300809 CTGGGGAATGCTAACATTTCAGG + Intronic
1173697300 20:45029633-45029655 CTAGGTGATGCTAACACTGCTGG - Intronic
1174313995 20:49682831-49682853 ATCTGCAATCCTAACACTTCAGG + Intronic
1174588045 20:51624036-51624058 CTGGCCATTCCTAAGACTTCTGG - Intronic
1175793972 20:61759899-61759921 CTCGGCATTCCTAACACTTTGGG - Intronic
1179316235 21:40246745-40246767 CTGGGGACTCCTCACACAGCAGG - Intronic
1179663923 21:42896572-42896594 CTGGCCAATCCCAGCACTTCAGG + Intronic
949107000 3:211355-211377 CTGTGCTCTCATAACACTGCAGG - Intronic
959099973 3:101999360-101999382 CTGGCCAATTTAAACACTGCTGG - Intergenic
959500923 3:107105298-107105320 CTGGCCAATGCCAGCACTGCAGG + Intergenic
970302872 4:14700143-14700165 CTGGGCAATCTGAAGACTGTTGG - Intergenic
971807473 4:31378553-31378575 CTGGCAAATCCAAACTCTGCAGG + Intergenic
979764168 4:124445222-124445244 CAGGGCAATCCCAACACCTCTGG + Intergenic
981780864 4:148427573-148427595 CTGGGCTGTCCTCACCCTGCTGG - Intronic
984194362 4:176640563-176640585 CTGGGCAATCCAAACACTTGGGG + Intergenic
985982872 5:3486991-3487013 CAGCGCAATCCTAACACTTTGGG + Intergenic
993984273 5:94578837-94578859 CTGGGTGATGGTAACACTGCTGG + Intronic
994761152 5:103856023-103856045 CTGGGTAATCCCAGCACTTCGGG + Intergenic
995548325 5:113254903-113254925 CTGGGCAATCCCAGCACTTTGGG + Intronic
996544431 5:124662920-124662942 CTGGACAATGCTAACACTTGGGG + Intronic
1000259131 5:159569170-159569192 CTGGGCCATCCTCATACTTCAGG - Intergenic
1002338228 5:178495077-178495099 CTGGGCAAACCTCAACCTGCAGG - Intronic
1009709208 6:67296108-67296130 CTGGGCAATCAGAACAAAGCTGG - Intergenic
1010660086 6:78559777-78559799 CTGGACAATGTTTACACTGCTGG - Intergenic
1013279341 6:108621226-108621248 GTGGGCACTCCTAGCTCTGCAGG - Intronic
1016201325 6:141413212-141413234 CTGGGCATTGATAAAACTGCAGG + Intergenic
1025061761 7:55814845-55814867 CTGGGCAAAAATAACACTGGAGG + Intronic
1030939328 7:115626632-115626654 CTAGGCATTCCTAAAGCTGCAGG + Intergenic
1049696458 8:143986420-143986442 CTCAGCAAGCCTAACCCTGCTGG + Exonic
1051073124 9:13197418-13197440 CTGAGCAATTCTAACACTATCGG + Intronic
1054977433 9:71164320-71164342 CTGGTCAATTCAAACACAGCAGG - Intronic
1056203712 9:84300555-84300577 TTGTGCAATCCCAACACTGCAGG - Intronic
1056269104 9:84929356-84929378 CTGGGCAACCCTGTCACTGATGG - Intronic
1056638237 9:88348700-88348722 CTGGCCAATCCCAACACTTTGGG - Intergenic
1057293779 9:93823853-93823875 CTGGGGAATTCTCACACTGTTGG - Intergenic
1062467094 9:136686299-136686321 CTGGGCAGTCCAAACAGGGCAGG + Intronic
1062689053 9:137832163-137832185 CTGGCCAATCCTAGGACTGGAGG - Intronic
1193328191 X:80206900-80206922 CTGGGCCATTCTAGCATTGCTGG - Intergenic
1194434128 X:93849095-93849117 CGGGGCAATCCCAAGACTCCTGG + Intergenic
1197055785 X:122116704-122116726 CTTGGCAAGCCTAACTCTCCTGG + Intergenic
1198447786 X:136735555-136735577 CTGGGCAATCCAACCAGTGCGGG + Intronic
1200644335 Y:5762101-5762123 CTGGGCAATCCTGGCCATGCGGG - Intergenic
1200792220 Y:7309683-7309705 GTGGGTTATCGTAACACTGCAGG - Intergenic