ID: 1064672183

View in Genome Browser
Species Human (GRCh38)
Location 10:17726892-17726914
Sequence TCATTTCTATAAAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064672180_1064672183 -9 Left 1064672180 10:17726878-17726900 CCATTATAACAAGTTCATTTCTA No data
Right 1064672183 10:17726892-17726914 TCATTTCTATAAAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064672183 Original CRISPR TCATTTCTATAAAAGGTGGA TGG Intergenic
No off target data available for this crispr