ID: 1064676135

View in Genome Browser
Species Human (GRCh38)
Location 10:17762216-17762238
Sequence TAGCAGACTGAGATGTGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064676135_1064676138 -2 Left 1064676135 10:17762216-17762238 CCACGCCACATCTCAGTCTGCTA 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1064676138 10:17762237-17762259 TAAGTTTTCTCTTCTCCAATGGG No data
1064676135_1064676137 -3 Left 1064676135 10:17762216-17762238 CCACGCCACATCTCAGTCTGCTA 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1064676137 10:17762236-17762258 CTAAGTTTTCTCTTCTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064676135 Original CRISPR TAGCAGACTGAGATGTGGCG TGG (reversed) Intronic
901126841 1:6935433-6935455 GAGCAGACAGAGATGTGGCATGG - Intronic
904478014 1:30776981-30777003 TAGCAAACTGAGGCGTGGCCTGG - Intergenic
904648629 1:31987503-31987525 CAGCAGCCTGAGTTGTGGCCTGG - Intergenic
920796018 1:209137595-209137617 TAGAAATCTGAGATGTGGCCAGG + Intergenic
921163901 1:212492181-212492203 TGGGAAACTGAGGTGTGGCGAGG + Intergenic
924690684 1:246346841-246346863 TACCAGACTCAGATATGGCAAGG + Intronic
1063041530 10:2343625-2343647 AAGGAGACTGAGATGTGTCATGG - Intergenic
1063098523 10:2929304-2929326 TAGCAGAGTGAGGGGTGGGGAGG + Intergenic
1063451725 10:6154604-6154626 GAGCAGACTGTGGGGTGGCGGGG + Intronic
1064676135 10:17762216-17762238 TAGCAGACTGAGATGTGGCGTGG - Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1069447935 10:68491177-68491199 TAGCAAACTAAAATGTGGTGTGG - Intronic
1071574422 10:86715303-86715325 GAGCAGACTGAAATGTGGTGAGG + Intronic
1073135173 10:101216251-101216273 TAGCACGCTGAGATGTGGGAAGG + Intergenic
1074662311 10:115674761-115674783 TAGAAAAGTGAGATGTGGTGTGG - Intronic
1074978900 10:118603321-118603343 AAGCATAATGAGATGTGGCTTGG - Intergenic
1076585555 10:131545138-131545160 TAAAGGACTGAGATGTGGCAGGG - Intergenic
1076643942 10:131938516-131938538 TAGCAGGCTGAAATGGGGAGGGG - Intronic
1080384760 11:31804754-31804776 TAGCAGACTGGGAATTGCCGTGG - Intronic
1081337352 11:41882935-41882957 TAGGACACAGAGATGTGGAGTGG - Intergenic
1081782056 11:45719905-45719927 TAGCATGCTGGGATGTGGCATGG - Intergenic
1085555867 11:77421142-77421164 TAGCAGGGTGAGATGAGGGGAGG - Intronic
1085718271 11:78891695-78891717 GAGGAAACTGAGATGTGGAGAGG + Intronic
1089365799 11:117920192-117920214 TAGGAGACTGAGATGTAAAGAGG - Intronic
1093001491 12:14001712-14001734 TAGGAGACTGAGATGTCTCTGGG - Intergenic
1093713467 12:22354547-22354569 TAGCTGTCTCAGATGTGGTGTGG - Intronic
1097108171 12:56637301-56637323 TAGCCGACTGAGAGGTGCAGGGG - Intergenic
1098153413 12:67572108-67572130 TGGGAGACTGAGGTGGGGCGGGG - Intergenic
1101371068 12:104131172-104131194 TAGAAGACTGAGGTTTAGCGAGG - Intronic
1104611128 12:130228673-130228695 TAGGAGACTGAGATGTCCCTTGG - Intergenic
1106017515 13:25883765-25883787 CAGCAGACTGGGAGGTGGTGAGG - Intronic
1106288348 13:28337741-28337763 TAGCAATCTGTGATGTGGTGTGG + Intronic
1119903459 14:78281456-78281478 AAGCAGTCTGAGATGGGGCCTGG + Intronic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1126628141 15:50706094-50706116 TAGAAAACTGAGATATGGCCGGG + Exonic
1127651797 15:61016160-61016182 GAGAAGACTGAGATGTAGAGAGG - Intronic
1129033956 15:72638768-72638790 AAGAAGACTGAGGTGTGGCCAGG - Intergenic
1129215926 15:74098448-74098470 AAGAAGACTGAGGTGTGGCCAGG + Intergenic
1131407458 15:92176893-92176915 GAGCAGACTGAGAAGAGGTGTGG - Intergenic
1133705943 16:8354672-8354694 TAGCAAACTGAGTTTTGGAGAGG + Intergenic
1136071206 16:27788382-27788404 TAGCAGACTGGGATGCGCCTGGG - Exonic
1137697152 16:50468985-50469007 TAGCAGGATGAGACGTGGGGAGG - Intergenic
1143766478 17:9141096-9141118 GAGCAATCTGAGATGTGGGGTGG + Intronic
1145102730 17:20090173-20090195 AAGAAGACAGAGATGTGGTGTGG - Intronic
1147419039 17:40312899-40312921 AAGCACACTGAGCTGTGGTGAGG - Intronic
1148964462 17:51422945-51422967 TGGCAGACTGTGATGAGGCAGGG + Intergenic
1153189288 18:2519960-2519982 TAGGAGACTGAGAGGTGGGAGGG + Intergenic
1153410666 18:4789270-4789292 TAGCAGACTGAGAGGTGATCAGG - Intergenic
1159081376 18:63739627-63739649 TACCAGACTGGGATTTGGCAGGG + Intergenic
1164454453 19:28395646-28395668 TAGAAGAGTGAGATGGGGCCAGG + Intergenic
1164698095 19:30261963-30261985 CAGCAGCCTGAGATGTGAAGAGG - Intronic
1166282422 19:41803107-41803129 AACCAGACTCAGATGTGGCAGGG + Intronic
1167356370 19:49006717-49006739 TGGGAGACTGAGGTGTGGCGAGG + Intronic
930067201 2:47336704-47336726 TAGAAGACAGAGATGGGGCAAGG - Intergenic
930813946 2:55572763-55572785 TACCACAGTGAGATGTGGAGTGG + Intronic
931992253 2:67802275-67802297 TAGCACAGTGAGTTGTGGTGAGG - Intergenic
933169933 2:79113963-79113985 TAGCAGACTGGGAAGTGGATTGG + Intergenic
934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG + Intronic
935368109 2:102316007-102316029 TGGCAGACTGAGATAAGGGGAGG - Intronic
941266149 2:163365789-163365811 AACCAGACTCAGATATGGCGGGG - Intergenic
946276383 2:218634822-218634844 GAGCAGACTGAGGTATGGAGAGG - Intronic
946352163 2:219162257-219162279 TAGCAGACTGGGGAGTGGCCAGG - Intronic
1168898061 20:1337629-1337651 GAACAGACTGGGATGTGGCCAGG - Intronic
1170667657 20:18400631-18400653 AAGCAGGCTGAGATCTGGCTTGG + Intronic
1171904781 20:30892279-30892301 TAGAAGAGTGAGAGGTGGAGGGG - Intergenic
1172997787 20:39083697-39083719 GAGCAGACCCAGATGTGGAGGGG + Intergenic
1173001141 20:39106582-39106604 TAAGTGACTGAGATCTGGCGGGG - Intergenic
1179116142 21:38494274-38494296 TAGCACACTGTGCTCTGGCGGGG - Intronic
1181811696 22:25407014-25407036 TAGCAGGGTGAGATGTGGGAAGG - Intergenic
1181812718 22:25413760-25413782 TAGCAGCCTGAGCTGTGTCTAGG + Intergenic
1181863496 22:25837329-25837351 CAGGAGACTGAGGTGTGGCCAGG + Intronic
1184640791 22:45868922-45868944 TAGCAGACTGGGAGGAGGTGTGG - Intergenic
1185029495 22:48434252-48434274 TGGCAGAGTGTGATGTGGCCAGG + Intergenic
950881103 3:16323213-16323235 TAGCAGCCTGAGATGTGATTCGG + Intronic
951059217 3:18185109-18185131 TAGCAAACTTAGATGTGGTTAGG + Intronic
951072652 3:18350371-18350393 TAGCAAACTCAGATGTGGTTAGG + Intronic
952425158 3:33168115-33168137 TATCAGAGTGGGATGTGGCTGGG + Intronic
952457401 3:33486523-33486545 AAGTAGACTGAGGAGTGGCGAGG + Intergenic
955957430 3:64304934-64304956 TAGAGGACTGAGATGTTGCTGGG + Intronic
956821933 3:72961830-72961852 TAGAAAACTGAGATGTGGGTAGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
961065218 3:123869586-123869608 TTGCAGACTGGGATATGGAGAGG - Intronic
963583679 3:147157744-147157766 GAGCAAACTGAGAGGTGGTGAGG + Intergenic
964369347 3:155983582-155983604 AAGCAGACTCACATGTGGCAGGG - Intergenic
967245829 3:187485477-187485499 GAGGAGACTGAGATCTGGAGAGG + Intergenic
976194725 4:82521736-82521758 TAACTGATTGAGATGTGACGTGG + Intronic
976196832 4:82540353-82540375 TAGGAGGCTGAGGTGTGGGGAGG - Intronic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
981309710 4:143285064-143285086 TTGCAGACTGTGAGGTGGCATGG - Intergenic
982348334 4:154386046-154386068 TAGCAGACTGTGGGGTGGAGTGG - Intronic
984609470 4:181821212-181821234 TAGCAGACTGAGATGCGGTGAGG - Intergenic
985689745 5:1300592-1300614 TAACAAACTGGGATGTGGCTGGG - Intergenic
986976054 5:13395441-13395463 CAGCAGACTCAGATTTGGCCTGG + Intergenic
987085200 5:14461453-14461475 TAGCAGACTGAGATTTAGTGGGG + Intronic
987443872 5:17992050-17992072 CAGCAGCCTGGGATCTGGCGAGG - Intergenic
987874925 5:23668826-23668848 TAGTAGACTGAGACGTTGCAGGG - Intergenic
988012270 5:25504792-25504814 AAGCAGACATAGATGTGGTGGGG - Intergenic
993935876 5:94001792-94001814 CATCAGACCGAGATGTGGCAGGG - Intronic
996954643 5:129168366-129168388 TAGAAGACTGTGATGTGGAAGGG - Intergenic
997417791 5:133742243-133742265 GAGCAGACTGACATGTGGCCAGG + Intergenic
997518394 5:134506579-134506601 CAGCAGGCTGAGAGGTGGGGGGG - Intergenic
1000361422 5:160451208-160451230 TAGCAGCCTGAGAAGGGGCCTGG + Intergenic
1000994510 5:167945386-167945408 GAGGAGACTGAGGTGTGGGGAGG - Intronic
1003110818 6:3250778-3250800 GAAGAGACTAAGATGTGGCGTGG + Intronic
1005859145 6:29888011-29888033 TAGCCGACGGAGATGAAGCGGGG - Intergenic
1006043235 6:31271790-31271812 TAGCCCACTGAGATGAAGCGGGG + Exonic
1006052822 6:31356879-31356901 TAGCCCACTGAGATGAAGCGGGG + Exonic
1010768462 6:79802421-79802443 TAGAAGCCTGAGATCTGGAGTGG - Intergenic
1013720444 6:113019647-113019669 AAGCAGACTCAGATATGGCAGGG + Intergenic
1018877163 6:167832412-167832434 AAGCAGGCTGAGAGGTGGCAAGG + Intronic
1020533349 7:9362695-9362717 TAGGAGACTGAGATGGGAGGAGG + Intergenic
1022892434 7:34714952-34714974 TACCAGCCTGGGATGTGGGGTGG - Intronic
1023345197 7:39264564-39264586 TGACAGACTAAGATGTGGTGAGG + Intronic
1023508618 7:40926114-40926136 TAGCAGAATGAGCAGTGGAGTGG - Intergenic
1024298082 7:47862358-47862380 GAGCAGCCTGAGATGAGGAGGGG + Intronic
1026105685 7:67419049-67419071 TAGCAGGCTGAGTTGTGGGTGGG - Intergenic
1030490331 7:110224804-110224826 AAGCAGACAGAGATGTGGCATGG + Intergenic
1037576839 8:20213794-20213816 TAGCAGAGTAAGATATGGTGAGG - Intronic
1046080329 8:109362954-109362976 AAGTAGACTGAAATTTGGCGGGG + Intronic
1048367136 8:133747964-133747986 AAGGAGAGTGAGATGTGGAGAGG + Intergenic
1048984771 8:139729567-139729589 GAGCACACTGTGATGTGGTGTGG - Intergenic
1048985652 8:139733431-139733453 TAGCAGGCTAAGATGTGGGGTGG + Intronic
1053414079 9:37935425-37935447 TGGCAGACTGGGAAGTGGTGGGG + Intronic
1057303475 9:93899617-93899639 TGGGAGACTGAGATGTGGAGAGG - Intergenic
1059958649 9:119544128-119544150 TCTAAGACTGAGATGTGGGGAGG + Intergenic
1061366196 9:130173303-130173325 TGGCAGACAGAGATGGGGCCAGG - Intronic
1062191691 9:135251144-135251166 TAGCAGCCTGACAGGTGCCGTGG + Intergenic
1186586870 X:10884668-10884690 GAGGATACTGAGATGTGGAGAGG - Intergenic
1189239541 X:39515117-39515139 AAGGAGATTGAGATGTGGGGTGG - Intergenic
1190653293 X:52589171-52589193 TGGGAGACTGAGATGTGCCTGGG + Intergenic
1197664824 X:129212296-129212318 GAGGAAACTGAGATGTGGAGAGG + Intergenic
1197741344 X:129896845-129896867 TAACAGACTGAGATAGGGGGAGG + Intergenic
1197791442 X:130257879-130257901 TGGTAGACTGAGATGAGGCCAGG + Intronic
1201792186 Y:17854370-17854392 TAGCAGACTGATATGTACAGTGG - Intergenic
1201809368 Y:18051619-18051641 TAGCAGACTGATATGTACAGTGG + Intergenic
1202353787 Y:24023975-24023997 TAGCAGACTGATATGTATAGTGG - Intergenic
1202516992 Y:25646140-25646162 TAGCAGACTGATATGTATAGTGG + Intergenic