ID: 1064676398

View in Genome Browser
Species Human (GRCh38)
Location 10:17764620-17764642
Sequence CTAAGATCAAGCTGACGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064676396_1064676398 2 Left 1064676396 10:17764595-17764617 CCTGAAAGTTCTGGAGGTGAGAA 0: 1
1: 0
2: 8
3: 81
4: 452
Right 1064676398 10:17764620-17764642 CTAAGATCAAGCTGACGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064676398 Original CRISPR CTAAGATCAAGCTGACGGCA AGG Intronic
No off target data available for this crispr