ID: 1064676566

View in Genome Browser
Species Human (GRCh38)
Location 10:17765792-17765814
Sequence GCGCCCAACTTAAAACCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064676566_1064676570 -9 Left 1064676566 10:17765792-17765814 CCCTGTGGTTTTAAGTTGGGCGC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1064676570 10:17765806-17765828 GTTGGGCGCCTCTGGGCTTGTGG No data
1064676566_1064676573 18 Left 1064676566 10:17765792-17765814 CCCTGTGGTTTTAAGTTGGGCGC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1064676573 10:17765833-17765855 AGCACCAGTCTCCCTGGCTTTGG No data
1064676566_1064676572 12 Left 1064676566 10:17765792-17765814 CCCTGTGGTTTTAAGTTGGGCGC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1064676572 10:17765827-17765849 GGTTGCAGCACCAGTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064676566 Original CRISPR GCGCCCAACTTAAAACCACA GGG (reversed) Intronic
905905407 1:41614897-41614919 GCTCCCTACTTAAAACAGCATGG - Intronic
916338353 1:163698703-163698725 ATGCCCACCTTTAAACCACAGGG + Intergenic
921331619 1:214044313-214044335 GATCACAACTTAAAACAACATGG - Intergenic
1063504168 10:6580656-6580678 TCGCCCAACTGAAAACGAAACGG + Intergenic
1063750316 10:8936623-8936645 GAGCACAAATTAAAATCACAAGG - Intergenic
1064676566 10:17765792-17765814 GCGCCCAACTTAAAACCACAGGG - Intronic
1067855616 10:49790195-49790217 TTGCCCAACTTTTAACCACAGGG + Intergenic
1071541273 10:86486629-86486651 GGGCCTAGCTTTAAACCACAGGG + Intronic
1079261310 11:18884617-18884639 GCTCCCACCTGAAAATCACAGGG - Intergenic
1079269390 11:18969462-18969484 GCTCCCACCTGAAAATCACAGGG - Intergenic
1079858622 11:25638782-25638804 GTCCCCAACTTATAACCAAAAGG - Intergenic
1086587825 11:88476298-88476320 CTGCCCAAATTAAAACTACATGG - Intergenic
1092129090 12:6096031-6096053 GTGCTCAACCTAACACCACAGGG + Intronic
1095871642 12:47034872-47034894 GCAGCCACCTTACAACCACAAGG - Intergenic
1099535427 12:83837735-83837757 GCACCCAACCTAATACCACATGG - Intergenic
1099768238 12:87018729-87018751 GAACCCAACTTTAAACCTCAAGG + Intergenic
1103074312 12:117969480-117969502 GCGCCCAACTTTAAAACCCTCGG + Intergenic
1112498851 13:99926777-99926799 GCTCCCCACTTCAAACCAAATGG - Intergenic
1115005203 14:28474154-28474176 CCACCCAACTTCAAACTACAAGG - Intergenic
1115978613 14:39024106-39024128 GATACCAACTTAAAACCAAAAGG + Intergenic
1129836359 15:78709752-78709774 GAGCCCAGCTTAAACCAACAAGG + Intronic
1135292195 16:21249539-21249561 CATCCCATCTTAAAACCACATGG - Intronic
1142334978 16:89482602-89482624 GGGCCCAATTTGTAACCACAAGG + Intronic
1160372422 18:78384929-78384951 GCTCACAAATTAAACCCACATGG - Intergenic
925596136 2:5557212-5557234 GTTCCAAACTTAAAACCTCATGG - Intergenic
935932191 2:108139315-108139337 GCTCCCATCATAAAACCCCAAGG + Intergenic
937830884 2:126421793-126421815 AAGCACAAATTAAAACCACAAGG - Intergenic
942797431 2:179838445-179838467 GCGCCTAACTTCTAATCACATGG + Intronic
943091742 2:183383842-183383864 GTACCCAACTGTAAACCACATGG - Intergenic
943561475 2:189468456-189468478 GTGCCTAGATTAAAACCACAAGG - Exonic
1172515255 20:35528693-35528715 GCACCCACCTGAAAACCACGGGG + Exonic
1182864085 22:33586747-33586769 GCGCCCAGCTGAGAACAACAAGG + Intronic
1184200452 22:42965074-42965096 GCGCACAGCTGAAAACCACTCGG + Intronic
963036721 3:141036627-141036649 ACCCCCATCTAAAAACCACAAGG + Intergenic
964159096 3:153624699-153624721 AAGCCCAACTGAAAAACACAGGG - Intergenic
965169042 3:165236833-165236855 TTGCCCAACTTAAAGTCACAAGG + Intergenic
965380416 3:167981345-167981367 GCTCCCAATTTAAACCCTCAGGG + Intergenic
966814554 3:183879415-183879437 GCAGCCATCTTATAACCACAAGG + Intronic
969712743 4:8853514-8853536 GTGCCCAACTGAAATCCAGAAGG + Intronic
973654288 4:53029897-53029919 TTGCCTAACCTAAAACCACAAGG - Intronic
974611678 4:64226662-64226684 GTGCCTAAGTTAAAACCATAAGG + Intergenic
977070676 4:92381828-92381850 TTGCCAAAATTAAAACCACAGGG - Intronic
986509670 5:8491032-8491054 CCCCCCACCTTTAAACCACAGGG + Intergenic
989739204 5:44749595-44749617 ACGTCCACCTTTAAACCACATGG - Intergenic
991538197 5:67696608-67696630 GGGCCCAACTTGAAGACACAAGG + Intergenic
995726707 5:115188994-115189016 GTGCCCAACTTAAAAAGAAAAGG + Intergenic
1001492907 5:172168372-172168394 GGGCCCAACATAAAGCCAAAGGG + Intronic
1005412828 6:25568386-25568408 GCGCCCAGCCTAGGACCACATGG + Intronic
1012358459 6:98346308-98346330 ATGCCCAACTTATAACTACAAGG - Intergenic
1014084668 6:117329721-117329743 GAGCCCACCTGAGAACCACACGG + Intronic
1031253380 7:119415983-119416005 AAGCCCAACTTAACAGCACAAGG - Intergenic
1033932166 7:146537603-146537625 CCACCCAACTTAAAATCGCAAGG - Intronic
1041590363 8:59573480-59573502 GCTTTCAAATTAAAACCACAAGG + Intergenic
1051415163 9:16832175-16832197 GCGCCCTTATTAAAACTACAAGG + Intronic
1056798902 9:89677788-89677810 GAGCCCAACTGCAAACCAAATGG + Intergenic
1056909241 9:90683064-90683086 GAGACCAACTGAAAAACACAGGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1193719612 X:84971908-84971930 GGGCCCAACTGAGAGCCACATGG - Intergenic
1194383051 X:93219250-93219272 GAGCCCAACTAAAAGCCAGAAGG + Intergenic
1198944721 X:141997796-141997818 GAGCAAAACTTAAAACCTCAGGG - Intergenic
1200266535 X:154649165-154649187 GCCCCCAATTTACACCCACACGG - Intergenic