ID: 1064685818

View in Genome Browser
Species Human (GRCh38)
Location 10:17860080-17860102
Sequence ACATTAATACCACAGCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064685817_1064685818 -8 Left 1064685817 10:17860065-17860087 CCATATTCTGTATGGACATTAAT No data
Right 1064685818 10:17860080-17860102 ACATTAATACCACAGCCTTTAGG No data
1064685813_1064685818 21 Left 1064685813 10:17860036-17860058 CCTGCCTCAAGTGAGACAAAGGC No data
Right 1064685818 10:17860080-17860102 ACATTAATACCACAGCCTTTAGG No data
1064685811_1064685818 22 Left 1064685811 10:17860035-17860057 CCCTGCCTCAAGTGAGACAAAGG No data
Right 1064685818 10:17860080-17860102 ACATTAATACCACAGCCTTTAGG No data
1064685810_1064685818 28 Left 1064685810 10:17860029-17860051 CCAACTCCCTGCCTCAAGTGAGA No data
Right 1064685818 10:17860080-17860102 ACATTAATACCACAGCCTTTAGG No data
1064685814_1064685818 17 Left 1064685814 10:17860040-17860062 CCTCAAGTGAGACAAAGGCCAAA No data
Right 1064685818 10:17860080-17860102 ACATTAATACCACAGCCTTTAGG No data
1064685816_1064685818 -1 Left 1064685816 10:17860058-17860080 CCAAATACCATATTCTGTATGGA No data
Right 1064685818 10:17860080-17860102 ACATTAATACCACAGCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064685818 Original CRISPR ACATTAATACCACAGCCTTT AGG Intronic