ID: 1064686564

View in Genome Browser
Species Human (GRCh38)
Location 10:17867786-17867808
Sequence AAACTTGGGCTCTAAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064686564 Original CRISPR AAACTTGGGCTCTAAGAGCA TGG (reversed) Intronic
901209711 1:7517915-7517937 AACCCTGGGCTCTCAGAGCCAGG - Intronic
907130162 1:52090208-52090230 AAACTGAGGCTCAGAGAGCAAGG - Exonic
907485937 1:54778195-54778217 AAACTGAGGCCCAAAGAGCAGGG - Intergenic
910465499 1:87494826-87494848 AAACTGGTGTTCTTAGAGCAGGG + Intergenic
910494401 1:87810380-87810402 AAACATAAGCTCTAAGAGGAAGG - Intergenic
913136652 1:115897264-115897286 AAACTGGTTCTCTAAGAGTACGG + Intergenic
913382835 1:118229499-118229521 AAACTTGGAGTCAAAGTGCAGGG - Intergenic
914340122 1:146753160-146753182 AAACTGGTGCCCTAAAAGCAGGG + Intergenic
919704147 1:200660317-200660339 AAAGTTGCCCTCCAAGAGCAAGG - Intronic
922239405 1:223745688-223745710 AAAATTAGGCTCTAAATGCAAGG + Intronic
923104402 1:230843360-230843382 AAACTTGGGTTCCGAGAACAGGG + Exonic
1064303235 10:14141338-14141360 AAAATGAGGCTCTAACAGCAGGG + Intronic
1064686564 10:17867786-17867808 AAACTTGGGCTCTAAGAGCATGG - Intronic
1065313367 10:24437683-24437705 ACACCTTGGCTCTAAGAGCCGGG + Intronic
1069983054 10:72265761-72265783 AAACCTGGCCTCTAAGTGGATGG + Intergenic
1070536469 10:77381844-77381866 CAAGTGGGGCTCTGAGAGCAAGG + Intronic
1071722944 10:88165614-88165636 AAACTTGGGCTCTTAGGAAATGG - Intergenic
1074266228 10:111906279-111906301 AAATTAGGGTTCTAAAAGCAAGG - Intergenic
1074730088 10:116362156-116362178 ACACTTGGGGTGTCAGAGCAAGG - Intronic
1075580352 10:123613013-123613035 AAACTTGGGCTTTCAAAGCTTGG + Intergenic
1076373590 10:129969387-129969409 AAACCTGCGCTCTAAGTGCCCGG + Intergenic
1078080304 11:8199589-8199611 AGACCTGGGCTCAAAGAGAAAGG + Intergenic
1079002549 11:16770122-16770144 AAGCTCGGGTTCTCAGAGCAGGG + Intergenic
1079276929 11:19048478-19048500 AAGCTTGTCCTCTAAGAACAGGG + Intergenic
1080885508 11:36363936-36363958 AAAAATGGTCTCTAAGAGGAAGG - Intronic
1081512516 11:43790205-43790227 ATACTTGGACGCTAAAAGCAAGG + Intronic
1081911542 11:46703108-46703130 AGACTTGGGCCCTCAGAGGAAGG - Exonic
1082019268 11:47517962-47517984 AAACTTGAGCTTTTGGAGCATGG + Intronic
1083667512 11:64284055-64284077 AAACTGGGGCTCTGAGAGTTTGG + Intronic
1084139448 11:67215298-67215320 ACACTTGGGCTCCAAGGGAAAGG - Intronic
1084520889 11:69662107-69662129 AGACTTGGGCTCTCAAAGCCTGG + Intronic
1088676764 11:112201703-112201725 AATCTTGGACTCTAACTGCATGG - Intronic
1088713962 11:112532374-112532396 AAAATTGGGCTGTAGAAGCAAGG + Intergenic
1089115219 11:116089499-116089521 AGACATGGGCTCCAAGAGCTGGG + Intergenic
1092162819 12:6325260-6325282 GAACTAGGACTCAAAGAGCAAGG + Intronic
1094358260 12:29601690-29601712 AAACCTGGGCTCTGAGAGGTTGG - Intronic
1096477050 12:51914628-51914650 AAACTTGAGCCCTGAGTGCAGGG - Intronic
1096734732 12:53643915-53643937 CAACCTGGGCGATAAGAGCAAGG - Intronic
1096829246 12:54301453-54301475 AAACCTGGGCTCTGGGAACAAGG + Intronic
1098166812 12:67707067-67707089 AAATTCTGGCTCTAAGAGCATGG - Intergenic
1107903186 13:45038645-45038667 ATACTTGTGCTCTAGCAGCAAGG - Intergenic
1112682315 13:101780892-101780914 ACACTGGAGCTCTTAGAGCAAGG - Intronic
1114971805 14:28040177-28040199 AAACTTTTTCTCTAAGATCAGGG + Intergenic
1117783006 14:59254349-59254371 AAACTTGGCCTCTTAGATGAGGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118871723 14:69748588-69748610 AAACTTGTTCTCTAAAATCATGG + Intronic
1121945933 14:98122060-98122082 ACACATGTTCTCTAAGAGCAGGG - Intergenic
1202847828 14_GL000009v2_random:197529-197551 AAACTTAGGAGCTAAGACCAGGG + Intergenic
1202917304 14_GL000194v1_random:188068-188090 AAACTTAGGAGCTAAGACCAGGG + Intergenic
1124022308 15:25935846-25935868 AAGCTTGGGCCCTGACAGCATGG + Intergenic
1124048314 15:26171849-26171871 ATACTTGATCTGTAAGAGCACGG - Intergenic
1124447989 15:29756210-29756232 AGACTTGGGCTGTAGGAGCTGGG - Intronic
1127855068 15:62947401-62947423 AATCCTGGTCACTAAGAGCAGGG + Intergenic
1129545727 15:76392966-76392988 AAACTTTGGCCCTACGAGCTGGG + Intronic
1130163033 15:81421136-81421158 AAACCAGAGCTCTGAGAGCAAGG + Intergenic
1131136139 15:89937306-89937328 AAACTTGAGCTCAAAAAGTAAGG + Intergenic
1133826217 16:9280535-9280557 AAACCAGGGCTCAAAGAGGAAGG - Intergenic
1135111114 16:19691502-19691524 AAACTTGTGCTTTCAGAGCAAGG - Intronic
1139994166 16:70964248-70964270 AAACTGGTGCCCTAAAAGCAGGG - Intronic
1140032231 16:71348076-71348098 AAACTTGGGTTCTAAATGAAGGG + Intergenic
1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG + Intergenic
1152785769 17:82247175-82247197 CAACGTGGGCTCTAACAGCAGGG - Intronic
1153635006 18:7106020-7106042 CAACGTGGTCTCTAAGTGCAGGG + Intronic
1155577892 18:27267958-27267980 AAATTTGGGCTCTCAGATTATGG - Intergenic
1156503318 18:37573678-37573700 AAATTGAGGCTCTGAGAGCATGG - Intergenic
1160936555 19:1598898-1598920 AAAATGGGGGTGTAAGAGCACGG + Intronic
1164226471 19:23250316-23250338 AGGCTGGGCCTCTAAGAGCAGGG + Exonic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1168250798 19:55140849-55140871 ACATTTGGGCTCTCAGGGCAGGG + Intronic
1202675174 1_KI270710v1_random:37672-37694 AAACTTAGGAGCTAAGACCAAGG + Intergenic
928059982 2:28102099-28102121 AAAGGTAGGCTCTAAGAGGAGGG + Intronic
929265125 2:39910030-39910052 AAACTTTGGTTCTCAGGGCAGGG - Intergenic
931275335 2:60739295-60739317 AAACCTTGTCTTTAAGAGCAAGG - Intergenic
932441338 2:71737592-71737614 AAACTGAGGCTCAGAGAGCATGG - Intergenic
935066830 2:99656038-99656060 AAACTGGGGGCATAAGAGCAGGG + Intronic
935281918 2:101525761-101525783 TAACTTGGCCTCTAAGACCCTGG - Intergenic
940906071 2:159171096-159171118 AATTTGGGGCCCTAAGAGCAAGG + Intronic
942548208 2:177086842-177086864 AAAATTGTGCTCTCAGAGTAGGG + Intergenic
942856278 2:180553300-180553322 AAACTTGCTGTCTGAGAGCAAGG + Intergenic
946179521 2:217941284-217941306 GAACATGGGCTCTAACTGCAGGG + Intronic
946757377 2:222961487-222961509 AAACTTGGGCACCAAGAAAAAGG - Intergenic
948285679 2:236783256-236783278 AAACTATGGCTCTGACAGCATGG - Intergenic
1169307216 20:4502452-4502474 GAGCTTGGGCTTTAAGAACATGG - Intergenic
1170303097 20:14907962-14907984 AAACTTGGGTTCCAAGTTCATGG - Intronic
1171295143 20:24010918-24010940 AAACATGGGCCCTAAGAACCAGG - Intergenic
1172178597 20:32987247-32987269 AAACTGAGGCTCAAAGAGCCAGG - Intronic
1174946668 20:54993776-54993798 TAACTTGGTCTCTGAGAGCTGGG + Intergenic
1175748933 20:61481444-61481466 AAGCCTGGGCTGTAACAGCAAGG - Intronic
1177752282 21:25299143-25299165 GAACTTTGGCTCAAAGGGCATGG - Intergenic
1177791297 21:25724667-25724689 AAATTTGGGATCTAAGAAGAGGG + Exonic
1181000561 22:19986117-19986139 AAACTTGGGGTGGGAGAGCAGGG + Intronic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
951188992 3:19747532-19747554 AAGCTTGTGCTGTAAAAGCAGGG - Intergenic
952641641 3:35603731-35603753 AGGCTTGGGATATAAGAGCAAGG + Intergenic
954007895 3:47607452-47607474 AAACTTTGGCTCTAAGCACTTGG + Intronic
955118928 3:56036272-56036294 AAACTTTTCCTCTAAGATCAGGG + Intronic
957103986 3:75862770-75862792 AAACTTAGGAGCTAAGACCAGGG + Intergenic
961864875 3:129946316-129946338 AAAGTTGGGCATTAAAAGCAAGG + Intergenic
966812333 3:183858207-183858229 AAAGATGGGCTATAAGACCAAGG + Intronic
972294067 4:37719747-37719769 ATACTTGGGCTCAAACAGCTGGG - Intergenic
972643533 4:40946701-40946723 AAACTTGAGCTCTAAACCCAGGG + Intronic
976942291 4:90717921-90717943 AAACTTAAAGTCTAAGAGCAGGG + Intronic
979415665 4:120435029-120435051 AAACTAGGGCTTTAAGCTCAGGG - Intergenic
982278147 4:153658051-153658073 AAACTGGGGATATTAGAGCAGGG - Intergenic
983250289 4:165336763-165336785 AGACTTGTGCTCTAATACCAGGG - Intronic
984585891 4:181563774-181563796 TCACTTGGGGTTTAAGAGCATGG - Intergenic
985964443 5:3329375-3329397 CAACGGGGGCTCTATGAGCACGG + Intergenic
987829717 5:23079461-23079483 AAACGTTGGCTCTAAGACAATGG - Intergenic
988255703 5:28817843-28817865 AAGCTTGGGGGCTAAGAGGAAGG + Intergenic
988985838 5:36618157-36618179 AAATTTGGGCTTTAGAAGCAGGG - Intronic
989336282 5:40320517-40320539 AAACTTATGCTCTTAGAGCTGGG - Intergenic
990797739 5:59563736-59563758 AAACTTGGTGGCTAAGAGCATGG - Intronic
994544126 5:101141080-101141102 AAACTGGTTCTCTAAGAGCAAGG - Intergenic
996822431 5:127645160-127645182 ATACTTTGGCTCTAACAGCCTGG - Intergenic
997630934 5:135368578-135368600 AATCTTGGTCTCTAAGAAAATGG - Intronic
998966162 5:147542641-147542663 AATCTTGGGAACAAAGAGCAAGG + Intergenic
999015005 5:148093059-148093081 AAACATGGGCATAAAGAGCATGG - Intronic
1001193486 5:169651638-169651660 CCACTTGGGCTGAAAGAGCAGGG + Intronic
1005008066 6:21309908-21309930 AAACTGGGTCACAAAGAGCAGGG + Intergenic
1006699347 6:35959123-35959145 AAGCTTGGCCGCTAAGAGCCAGG + Intronic
1007276759 6:40679772-40679794 AAACTGGGGCTCTCTGAGGATGG - Intergenic
1007704525 6:43782763-43782785 AGACTGGGGCTCTGAGGGCAAGG + Intronic
1009981172 6:70727696-70727718 GAATTTGGGCTCTAAAATCAGGG + Intronic
1015687799 6:135885185-135885207 AATATTTGGCTCTAAGAGTAGGG - Intronic
1016700079 6:147044453-147044475 AAATGTGGGAGCTAAGAGCACGG + Intergenic
1017769874 6:157636669-157636691 AAAAGTGGGGTCTAAAAGCAAGG + Intronic
1017900682 6:158716277-158716299 AAATTTGGGCTCTAAGAAATAGG - Intronic
1022920466 7:35008252-35008274 AACTCTGGGCTCTGAGAGCATGG - Intronic
1024155141 7:46614488-46614510 AAACTTGGGCCTTAAGAGAAAGG + Intergenic
1024329331 7:48140698-48140720 TAACTGGGACTCTGAGAGCAAGG - Intergenic
1024748224 7:52431519-52431541 AGCCTGGGGCTCCAAGAGCAGGG + Intergenic
1025236112 7:57235899-57235921 AAGCCTGGGCTCTTAGAGCCAGG - Intergenic
1029746128 7:102516709-102516731 AAACTGAGGCTCTAGGAGCAGGG + Intronic
1029764066 7:102615688-102615710 AAACTGAGGCTCTAGGAGCAGGG + Intronic
1030857783 7:114583058-114583080 AACTGTGGACTCTAAGAGCAAGG - Intronic
1031328152 7:120428677-120428699 GAACTTTGGCTCTAGGAGGAAGG + Intronic
1032921304 7:136550909-136550931 AAGCATGGGGTCTCAGAGCAGGG + Intergenic
1033669876 7:143481627-143481649 AAACTGAGGCTCAGAGAGCAAGG + Intergenic
1036361333 8:8079096-8079118 GAACTTGGCCTCTGAGTGCATGG + Intergenic
1038882790 8:31633312-31633334 AAACTTGTGCTCAAAGAGGAGGG + Intergenic
1041336068 8:56785671-56785693 AACCTTGTGCTTTAAGAGCCTGG + Intergenic
1043799855 8:84594899-84594921 AACCTTGAGCTTTTAGAGCATGG + Intronic
1044959082 8:97512403-97512425 AGACTTGGGCTCTTGGAGAAGGG + Intergenic
1046787489 8:118283823-118283845 GAACTTGGGCTTGAAGAGTAAGG + Intronic
1048533661 8:135273265-135273287 ACACTTGTGCCCTGAGAGCACGG + Intergenic
1051105721 9:13577782-13577804 AAACTTGGATTGTAATAGCAGGG + Intergenic
1055559795 9:77511306-77511328 ACTCTTGGAGTCTAAGAGCAAGG - Intronic
1057930533 9:99189356-99189378 CAACTTTGGCTACAAGAGCAGGG - Intergenic
1058719093 9:107747416-107747438 AAACTGGGCATCTCAGAGCACGG - Intergenic
1060755863 9:126212885-126212907 GAACTTGGGCACTGAGAGCCCGG + Intergenic
1061015401 9:127978384-127978406 ACACATGGGCTCTCAGAACAGGG + Intronic
1203652993 Un_KI270751v1:146287-146309 AAACTTAGGAACTAAGACCAGGG + Intergenic
1185937401 X:4274192-4274214 AAACTTGCTCTCTATGAGCTGGG + Intergenic
1186163444 X:6802229-6802251 AAACTGAGGCTCGAAGAGGATGG + Intergenic
1192074560 X:67979619-67979641 AAATTTGGGCTCCATGAGAATGG + Intergenic
1193608003 X:83592324-83592346 AAACTGAGGCTCTAAAAACATGG - Intergenic
1196674975 X:118410150-118410172 AAATTTGGGCTTTAAGTTCATGG + Intronic
1198683211 X:139203614-139203636 AAGCTTGGGTTCTGACAGCAGGG + Intronic
1201669206 Y:16497671-16497693 CATCTTGGGCTCTAAGAGACAGG - Intergenic