ID: 1064688110

View in Genome Browser
Species Human (GRCh38)
Location 10:17885365-17885387
Sequence GAGGAGTCCATTACACAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064688109_1064688110 -6 Left 1064688109 10:17885348-17885370 CCTTTGGACGGATGGACGAGGAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1064688110 10:17885365-17885387 GAGGAGTCCATTACACAAACTGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064688110 Original CRISPR GAGGAGTCCATTACACAAAC TGG Exonic
900907299 1:5568549-5568571 GAGGAGGCAATGAAACAAACAGG - Intergenic
906184005 1:43846586-43846608 GAGGACTGCCTGACACAAACAGG - Intronic
913982268 1:143531889-143531911 GACTAGTCAATTACACAGACAGG + Intergenic
914391426 1:147226397-147226419 GAGGAGACCAAAACATAAACAGG + Intronic
918405583 1:184208757-184208779 GAGTAGCCCATGTCACAAACAGG + Intergenic
920288047 1:204895844-204895866 GAGGAGTCACTTACATAAAGGGG - Intronic
923800186 1:237201589-237201611 GGGAAGCCCATTACACAAACTGG + Intronic
1064100860 10:12462878-12462900 GAGGACTCCATTACCTTAACGGG - Intronic
1064688110 10:17885365-17885387 GAGGAGTCCATTACACAAACTGG + Exonic
1065374671 10:25026661-25026683 CAGTAGTCCATTACACTAATTGG - Exonic
1066423593 10:35284367-35284389 GAGGAAGCGATTACACAAAGGGG - Intronic
1067221160 10:44345394-44345416 GAAGAGTCCATTACACTCATGGG + Intergenic
1067910433 10:50341053-50341075 GAAGAGTCAAATACAAAAACAGG + Intronic
1080352042 11:31396440-31396462 GAGGAGTTCATAACTCAAAAAGG + Intronic
1093512812 12:19949083-19949105 GAGGACTCCATCATACAAAGTGG - Intergenic
1093989687 12:25575861-25575883 GTGGAGAACATTACACACACTGG - Intronic
1096375274 12:51104228-51104250 GATGAGTCCATGACACATGCTGG + Intronic
1101454942 12:104821310-104821332 AAGGAGTCCATGACATAAAATGG + Intronic
1101573632 12:105978136-105978158 GATGTGTGCATTACACAACCAGG - Intergenic
1107041096 13:35948446-35948468 GAGGAGCGCATTACAAACACAGG - Intronic
1111998534 13:95189067-95189089 GAGGGGAACATTACACATACGGG - Intronic
1112905500 13:104414983-104415005 GCAGAGTCGATTACAAAAACAGG + Intergenic
1116869088 14:50054809-50054831 GAGGAGCCCATGAGACACACAGG + Intergenic
1118177195 14:63452861-63452883 GAGGAGTCCATTGCAGGATCTGG - Intronic
1122324128 14:100872644-100872666 GAGGGGTCCATTCGACAAACGGG - Intergenic
1202937701 14_KI270725v1_random:107078-107100 GAGCAGTCAATTACACAGATAGG - Intergenic
1124607199 15:31178458-31178480 GAGCAGTCCAGGACACAGACAGG - Intergenic
1128176354 15:65559584-65559606 GAGGAGTAGATCACACAAACAGG + Intronic
1133571505 16:7045028-7045050 GAGCTGTCCATTGCACAAAACGG - Intronic
1152120090 17:78413180-78413202 GACGAGCCCATTACAGGAACAGG + Intronic
1164835557 19:31353009-31353031 TCAGAGTCCACTACACAAACGGG + Intergenic
1166607333 19:44156128-44156150 GAAAAGACCATTACACAAACTGG + Intronic
1166937485 19:46343206-46343228 GAGCAGTGCCTTCCACAAACGGG - Exonic
927478331 2:23431175-23431197 GTGGAGTCCATGGCACCAACAGG + Intronic
927522739 2:23709998-23710020 CAGGAGTCCATGAGACAAAGGGG + Intergenic
930906371 2:56573088-56573110 GAGGAGACCCTTACACAAAGTGG - Intergenic
930965220 2:57314989-57315011 GAAGATTTCATTAAACAAACAGG + Intergenic
932596851 2:73099390-73099412 GAGGAGTCCATGGCACCAAAAGG + Intronic
938647633 2:133347724-133347746 GAGGGGCCCAATACACATACAGG - Intronic
939373720 2:141336322-141336344 GAGGTATCCATTATACATACAGG - Intronic
940213243 2:151277632-151277654 GAGGAGTCCAGGACTCATACTGG - Intronic
940835757 2:158519610-158519632 GAGGAAACCATAACACAAAGAGG - Intronic
1169588628 20:7115918-7115940 GAGGAGTCCATTTGACTGACAGG + Intergenic
1171391319 20:24803341-24803363 CAGGCGTCCACTACAGAAACTGG + Intergenic
1171449438 20:25225456-25225478 GAGGGGACCATCACACAGACAGG - Intronic
1177732064 21:25040208-25040230 GAGGAGACAATGACAGAAACAGG + Intergenic
1177893971 21:26839975-26839997 GAGGAGTCCAGTACACGATGAGG - Exonic
1179795116 21:43778096-43778118 GAGGAGTCAATCACACCAACAGG - Intergenic
952047859 3:29345749-29345771 GAGGAGGCCATTAAGGAAACAGG + Intronic
954031949 3:47825794-47825816 GAGTAGCCCATTACACCCACTGG - Intronic
954656266 3:52196063-52196085 GAGGAGGCTATTACTCCAACAGG - Intergenic
955534265 3:59906438-59906460 GAGGAGTCTGTAACACAAAGTGG + Intronic
956309027 3:67858747-67858769 GTGGACTCCCTTGCACAAACTGG - Intergenic
959825555 3:110791746-110791768 GATGAGTCCACTACAGAAACTGG + Intergenic
966813968 3:183873879-183873901 TAAGAGTACATTACACAAGCTGG + Intronic
970228860 4:13888478-13888500 AAGGAGTCCATTAGACACAATGG - Intergenic
971153838 4:24061818-24061840 GAGGACTCCTTTACCCATACTGG - Intergenic
976961504 4:90981601-90981623 GAGGAGTCCCTGTCACATACAGG + Intronic
978773855 4:112486115-112486137 GAGGAGTCAATTCCACCCACTGG - Intergenic
983860061 4:172694558-172694580 GAGAAGTCCTTTACAGAAATAGG - Intronic
986285980 5:6359449-6359471 GAGCCCTCCATTACAGAAACTGG - Intergenic
991644625 5:68789371-68789393 GAGGAGGCCATCACAAAAGCAGG - Intergenic
993400277 5:87440960-87440982 GAGGAGCTCATGACACAAAGGGG - Intergenic
996565154 5:124872351-124872373 CAGGATCCCATTACCCAAACAGG - Intergenic
1008193253 6:48486262-48486284 GTGGATGCCATAACACAAACAGG - Intergenic
1008813577 6:55535641-55535663 TAGGAGTCCTTTACCCAGACAGG - Intronic
1016526551 6:145007757-145007779 GAGCAGTACCTTGCACAAACTGG + Intergenic
1017974795 6:159347476-159347498 GAGGAGTCCACTACACAGCATGG - Intergenic
1021136832 7:16975191-16975213 AAGTAGTCCATTACACATACTGG - Intergenic
1021248214 7:18291055-18291077 GAGGTGTGGATTACACAACCTGG - Intronic
1023542439 7:41280283-41280305 AAAGAGTCAATTAGACAAACTGG - Intergenic
1028747795 7:94347415-94347437 CAGGTTACCATTACACAAACTGG - Intergenic
1036183810 8:6607309-6607331 GAGGAGGTGATTAGACAAACTGG - Intronic
1038052226 8:23824812-23824834 GAGGAGCCCATTCCAGAAATAGG - Intergenic
1044427246 8:92066239-92066261 GAGGAGACCCTTCCACAAAGTGG + Intronic
1051193014 9:14534478-14534500 GATGAGTTGATTACACAAGCAGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1186353525 X:8765560-8765582 GAGAGTTCCATTACACATACTGG - Intergenic
1187867013 X:23732234-23732256 GAGTAATCTATTACACAAAATGG + Intronic
1188011836 X:25064652-25064674 GAAGAGTCCATTAACCAAATAGG - Intergenic
1190582674 X:51903756-51903778 GGGGACTCCATTACCCAAGCTGG - Intergenic
1199206615 X:145156564-145156586 GAGGAGGACATCACACAAAATGG + Intergenic
1199493883 X:148431471-148431493 TAGGAGGCCATTCCACAAACTGG - Intergenic