ID: 1064692272

View in Genome Browser
Species Human (GRCh38)
Location 10:17930464-17930486
Sequence CTGGAGCTAAGTGGCTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064692268_1064692272 27 Left 1064692268 10:17930414-17930436 CCAGCTGGGACTCAACATCTTTT No data
Right 1064692272 10:17930464-17930486 CTGGAGCTAAGTGGCTATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064692272 Original CRISPR CTGGAGCTAAGTGGCTATAA TGG Intergenic
No off target data available for this crispr