ID: 1064707199

View in Genome Browser
Species Human (GRCh38)
Location 10:18085458-18085480
Sequence AATTAGCCAGGCATGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064707199_1064707206 20 Left 1064707199 10:18085458-18085480 CCTGCCACCATGCCTGGCTAATT No data
Right 1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG No data
1064707199_1064707207 24 Left 1064707199 10:18085458-18085480 CCTGCCACCATGCCTGGCTAATT No data
Right 1064707207 10:18085505-18085527 GTTTCACATGTTGCCCAGGCTGG No data
1064707199_1064707203 -9 Left 1064707199 10:18085458-18085480 CCTGCCACCATGCCTGGCTAATT No data
Right 1064707203 10:18085472-18085494 TGGCTAATTTTTCTATTCTTTGG No data
1064707199_1064707205 2 Left 1064707199 10:18085458-18085480 CCTGCCACCATGCCTGGCTAATT No data
Right 1064707205 10:18085483-18085505 TCTATTCTTTGGTAGAGACAGGG No data
1064707199_1064707204 1 Left 1064707199 10:18085458-18085480 CCTGCCACCATGCCTGGCTAATT No data
Right 1064707204 10:18085482-18085504 TTCTATTCTTTGGTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064707199 Original CRISPR AATTAGCCAGGCATGGTGGC AGG (reversed) Intergenic