ID: 1064707201

View in Genome Browser
Species Human (GRCh38)
Location 10:18085465-18085487
Sequence ATAGAAAAATTAGCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064707201_1064707204 -6 Left 1064707201 10:18085465-18085487 CCATGCCTGGCTAATTTTTCTAT No data
Right 1064707204 10:18085482-18085504 TTCTATTCTTTGGTAGAGACAGG No data
1064707201_1064707205 -5 Left 1064707201 10:18085465-18085487 CCATGCCTGGCTAATTTTTCTAT No data
Right 1064707205 10:18085483-18085505 TCTATTCTTTGGTAGAGACAGGG No data
1064707201_1064707207 17 Left 1064707201 10:18085465-18085487 CCATGCCTGGCTAATTTTTCTAT No data
Right 1064707207 10:18085505-18085527 GTTTCACATGTTGCCCAGGCTGG No data
1064707201_1064707206 13 Left 1064707201 10:18085465-18085487 CCATGCCTGGCTAATTTTTCTAT No data
Right 1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064707201 Original CRISPR ATAGAAAAATTAGCCAGGCA TGG (reversed) Intergenic