ID: 1064707202

View in Genome Browser
Species Human (GRCh38)
Location 10:18085470-18085492
Sequence AAAGAATAGAAAAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064707202_1064707207 12 Left 1064707202 10:18085470-18085492 CCTGGCTAATTTTTCTATTCTTT No data
Right 1064707207 10:18085505-18085527 GTTTCACATGTTGCCCAGGCTGG No data
1064707202_1064707206 8 Left 1064707202 10:18085470-18085492 CCTGGCTAATTTTTCTATTCTTT No data
Right 1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG No data
1064707202_1064707205 -10 Left 1064707202 10:18085470-18085492 CCTGGCTAATTTTTCTATTCTTT No data
Right 1064707205 10:18085483-18085505 TCTATTCTTTGGTAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064707202 Original CRISPR AAAGAATAGAAAAATTAGCC AGG (reversed) Intergenic