ID: 1064707206

View in Genome Browser
Species Human (GRCh38)
Location 10:18085501-18085523
Sequence CAGGGTTTCACATGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064707200_1064707206 16 Left 1064707200 10:18085462-18085484 CCACCATGCCTGGCTAATTTTTC No data
Right 1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG No data
1064707201_1064707206 13 Left 1064707201 10:18085465-18085487 CCATGCCTGGCTAATTTTTCTAT No data
Right 1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG No data
1064707202_1064707206 8 Left 1064707202 10:18085470-18085492 CCTGGCTAATTTTTCTATTCTTT No data
Right 1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG No data
1064707199_1064707206 20 Left 1064707199 10:18085458-18085480 CCTGCCACCATGCCTGGCTAATT No data
Right 1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064707206 Original CRISPR CAGGGTTTCACATGTTGCCC AGG Intergenic