ID: 1064710903

View in Genome Browser
Species Human (GRCh38)
Location 10:18123421-18123443
Sequence GAGTGGGTTAATGCAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064710903_1064710908 1 Left 1064710903 10:18123421-18123443 CCTCCATTTGCATTAACCCACTC No data
Right 1064710908 10:18123445-18123467 TTAATTTGCATGTAATTGAAAGG No data
1064710903_1064710910 13 Left 1064710903 10:18123421-18123443 CCTCCATTTGCATTAACCCACTC No data
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710903_1064710909 2 Left 1064710903 10:18123421-18123443 CCTCCATTTGCATTAACCCACTC No data
Right 1064710909 10:18123446-18123468 TAATTTGCATGTAATTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064710903 Original CRISPR GAGTGGGTTAATGCAAATGG AGG (reversed) Intergenic