ID: 1064710908

View in Genome Browser
Species Human (GRCh38)
Location 10:18123445-18123467
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064710903_1064710908 1 Left 1064710903 10:18123421-18123443 CCTCCATTTGCATTAACCCACTC No data
Right 1064710908 10:18123445-18123467 TTAATTTGCATGTAATTGAAAGG No data
1064710901_1064710908 3 Left 1064710901 10:18123419-18123441 CCCCTCCATTTGCATTAACCCAC No data
Right 1064710908 10:18123445-18123467 TTAATTTGCATGTAATTGAAAGG No data
1064710900_1064710908 6 Left 1064710900 10:18123416-18123438 CCACCCCTCCATTTGCATTAACC No data
Right 1064710908 10:18123445-18123467 TTAATTTGCATGTAATTGAAAGG No data
1064710904_1064710908 -2 Left 1064710904 10:18123424-18123446 CCATTTGCATTAACCCACTCCTT No data
Right 1064710908 10:18123445-18123467 TTAATTTGCATGTAATTGAAAGG No data
1064710902_1064710908 2 Left 1064710902 10:18123420-18123442 CCCTCCATTTGCATTAACCCACT No data
Right 1064710908 10:18123445-18123467 TTAATTTGCATGTAATTGAAAGG No data
1064710899_1064710908 7 Left 1064710899 10:18123415-18123437 CCCACCCCTCCATTTGCATTAAC No data
Right 1064710908 10:18123445-18123467 TTAATTTGCATGTAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064710908 Original CRISPR TTAATTTGCATGTAATTGAA AGG Intergenic
No off target data available for this crispr