ID: 1064710910

View in Genome Browser
Species Human (GRCh38)
Location 10:18123457-18123479
Sequence TAATTGAAAGGGAATATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064710904_1064710910 10 Left 1064710904 10:18123424-18123446 CCATTTGCATTAACCCACTCCTT No data
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710900_1064710910 18 Left 1064710900 10:18123416-18123438 CCACCCCTCCATTTGCATTAACC No data
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710902_1064710910 14 Left 1064710902 10:18123420-18123442 CCCTCCATTTGCATTAACCCACT No data
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710903_1064710910 13 Left 1064710903 10:18123421-18123443 CCTCCATTTGCATTAACCCACTC No data
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710906_1064710910 -4 Left 1064710906 10:18123438-18123460 CCACTCCTTAATTTGCATGTAAT 0: 5
1: 50
2: 102
3: 165
4: 470
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710899_1064710910 19 Left 1064710899 10:18123415-18123437 CCCACCCCTCCATTTGCATTAAC No data
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710907_1064710910 -9 Left 1064710907 10:18123443-18123465 CCTTAATTTGCATGTAATTGAAA 0: 27
1: 119
2: 226
3: 320
4: 550
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710905_1064710910 -3 Left 1064710905 10:18123437-18123459 CCCACTCCTTAATTTGCATGTAA 0: 4
1: 27
2: 72
3: 96
4: 306
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data
1064710901_1064710910 15 Left 1064710901 10:18123419-18123441 CCCCTCCATTTGCATTAACCCAC No data
Right 1064710910 10:18123457-18123479 TAATTGAAAGGGAATATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064710910 Original CRISPR TAATTGAAAGGGAATATAAG TGG Intergenic
No off target data available for this crispr