ID: 1064711379

View in Genome Browser
Species Human (GRCh38)
Location 10:18129765-18129787
Sequence TTTATGTTGTGAGTTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064711379_1064711381 9 Left 1064711379 10:18129765-18129787 CCCTCTGCAACTCACAACATAAA No data
Right 1064711381 10:18129797-18129819 TGCAGTTTAAAAATGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064711379 Original CRISPR TTTATGTTGTGAGTTGCAGA GGG (reversed) Intergenic
No off target data available for this crispr