ID: 1064712782

View in Genome Browser
Species Human (GRCh38)
Location 10:18143313-18143335
Sequence CAGTTTGGGCCGAGGTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064712778_1064712782 -2 Left 1064712778 10:18143292-18143314 CCAGGCAGCAGACAGATGTAACA 0: 1
1: 0
2: 0
3: 19
4: 173
Right 1064712782 10:18143313-18143335 CAGTTTGGGCCGAGGTAATAAGG No data
1064712777_1064712782 13 Left 1064712777 10:18143277-18143299 CCAGAGGTGAAGCTGCCAGGCAG 0: 1
1: 1
2: 2
3: 33
4: 655
Right 1064712782 10:18143313-18143335 CAGTTTGGGCCGAGGTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064712782 Original CRISPR CAGTTTGGGCCGAGGTAATA AGG Intronic
No off target data available for this crispr