ID: 1064716006

View in Genome Browser
Species Human (GRCh38)
Location 10:18177290-18177312
Sequence CTTTATCCACAGAGGGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064716001_1064716006 1 Left 1064716001 10:18177266-18177288 CCTCAGTAGGATCTGCAACCTAT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG No data
1064715999_1064716006 22 Left 1064715999 10:18177245-18177267 CCTGAGAAAAACAAACACGTGCC 0: 1
1: 0
2: 2
3: 24
4: 187
Right 1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064716006 Original CRISPR CTTTATCCACAGAGGGTTTT GGG Intronic
No off target data available for this crispr