ID: 1064717154

View in Genome Browser
Species Human (GRCh38)
Location 10:18188315-18188337
Sequence CTCTGGGAAGGAAGGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805
Summary {0: 1, 1: 1, 2: 10, 3: 92, 4: 701}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064717154_1064717160 -3 Left 1064717154 10:18188315-18188337 CCTTCTTGCCTTCCTTCCCAGAG 0: 1
1: 1
2: 10
3: 92
4: 701
Right 1064717160 10:18188335-18188357 GAGTCCCACTCTGTTGTGCAGGG No data
1064717154_1064717159 -4 Left 1064717154 10:18188315-18188337 CCTTCTTGCCTTCCTTCCCAGAG 0: 1
1: 1
2: 10
3: 92
4: 701
Right 1064717159 10:18188334-18188356 AGAGTCCCACTCTGTTGTGCAGG No data
1064717154_1064717163 6 Left 1064717154 10:18188315-18188337 CCTTCTTGCCTTCCTTCCCAGAG 0: 1
1: 1
2: 10
3: 92
4: 701
Right 1064717163 10:18188344-18188366 TCTGTTGTGCAGGGATGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064717154 Original CRISPR CTCTGGGAAGGAAGGCAAGA AGG (reversed) Intronic
900120684 1:1047482-1047504 ATCTGGGGAGGAAGGCCAGTGGG - Intronic
900142725 1:1145319-1145341 CCCGGGGAAGGAAGGCAAGGAGG + Intergenic
900380123 1:2379784-2379806 CTGTGGGCAGGAAGGTAAAAGGG + Intronic
900660176 1:3778203-3778225 CTCTGGGAGGGTAGGCCAGGCGG - Intergenic
901375320 1:8834194-8834216 CTCTGGGGAGGGTGGCAGGAAGG + Intergenic
901379004 1:8860529-8860551 CTCTGGGCAGGAAGGCAGAAGGG - Intergenic
901457119 1:9369414-9369436 CTCTGGGCTGGTAGGAAAGAAGG - Exonic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
901987380 1:13086648-13086670 GCCAGGGAAGGAAGTCAAGATGG + Intergenic
901994432 1:13140119-13140141 GCCAGGGAAGGAAGTCAAGATGG - Intergenic
903149874 1:21399108-21399130 CCCTGGGAAAGAAAGCAAAAGGG + Intergenic
903946468 1:26967020-26967042 CCCAGGGAAGGAAGGGAAGCAGG - Intergenic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904354927 1:29932843-29932865 CTCTGGGAAGGGAGGCTTGGTGG - Intergenic
904423531 1:30409206-30409228 GGCTGGGAGGGAAGGAAAGAAGG + Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904874512 1:33643880-33643902 GTCTGGGAATGAAGGAAGGAAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
907518493 1:55008240-55008262 ATCTTGGAAGGAAGCCAAGGGGG - Exonic
909592711 1:77370009-77370031 CTTTGGGAAGGAAAGCAACATGG - Intronic
910069365 1:83193184-83193206 CTCTTAGAAGGGAGGCAACATGG - Intergenic
910486295 1:87718121-87718143 TACTGGCAAGGAAGGGAAGATGG + Intergenic
911476930 1:98385135-98385157 CTCTGGGGAGAAAGGAAAAAAGG - Intergenic
911745246 1:101434720-101434742 CTCTGACAAGGAAGGTAACAGGG - Intergenic
912385095 1:109267525-109267547 CTGGGGGAAGGAAGCCAAAAGGG - Intronic
912460243 1:109825845-109825867 ATCTGAAAAGGAAGGAAAGAAGG - Intergenic
912529501 1:110310166-110310188 CTCTGCAAAGGAAAGCAAGCAGG - Intergenic
912728692 1:112082018-112082040 CTTTGGGAAGGAAGCCGAGGCGG - Intergenic
912967361 1:114248308-114248330 GTCTGGGGAAGAAGGAAAGAAGG - Intergenic
913038124 1:114994334-114994356 GTCAGGGAAGGAGGACAAGATGG + Intronic
913216067 1:116621403-116621425 CTCTGGGAAGCAAAGCCAGGAGG - Intronic
913997577 1:143664090-143664112 CTCAAGGAAGGAAGGAAGGAGGG - Intergenic
914264074 1:146022605-146022627 ATCTCGGAAGGAAGGAAGGAAGG - Intergenic
915099708 1:153490391-153490413 CCCTGGGAAGGAAGCCCAGATGG - Intergenic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915320447 1:155053187-155053209 CTCTGGGCAGGAAGCCGAGAAGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
915885914 1:159720813-159720835 CTATGGGAATGAGGCCAAGAAGG + Intergenic
915902265 1:159855426-159855448 CTCGGGGATGGAGGGAAAGATGG - Intronic
915904193 1:159866035-159866057 TTCTGGGAAGGACGGACAGAGGG + Intronic
915963249 1:160284404-160284426 CTCTGGGCAGGAAGTCAACAGGG + Intronic
916080563 1:161229451-161229473 CTCTGGGATGGAAAACAGGATGG - Exonic
916228453 1:162514596-162514618 TTGTAGGAAGGAAGGAAAGAAGG + Intronic
916641961 1:166739254-166739276 CTCTGGAAAGGATGGGAAGTTGG + Intergenic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
916844845 1:168639303-168639325 CTCTAGGAAGGAAGGAAGGAAGG - Intergenic
917437975 1:175040291-175040313 CACTGGGAAGGAAGTGTAGAGGG + Intergenic
917620054 1:176786384-176786406 AGCTGGGAAGGAATGCAAGGGGG + Intronic
917944484 1:179954954-179954976 CGCTGGGAAGGAAGACAAGGCGG - Exonic
918743677 1:188170457-188170479 CTCTGGGAAACAAGGAAAGATGG + Intergenic
919051193 1:192513410-192513432 CAGTGGGAAGGAAGGAAGGAAGG + Intergenic
919256211 1:195128393-195128415 GTCTGTGAAAGAAGACAAGAGGG - Intergenic
919674864 1:200371279-200371301 CTCTGGGAAGTGAGGACAGAAGG + Intergenic
920044349 1:203123895-203123917 CTCAGGTAAGGAAGGCATGAAGG - Intronic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
921427667 1:215022899-215022921 CTCTGGGAAGGAAAGAAGGAAGG - Intronic
921524547 1:216201040-216201062 CTGTCGGAAGGAAGGAAGGAAGG - Intronic
922436190 1:225609119-225609141 CTCCAGGAAGCAAGCCAAGAAGG + Intronic
922900141 1:229130229-229130251 CTCTGCACAGGAAAGCAAGAAGG - Intergenic
922911551 1:229221937-229221959 TTCTGGAAAGGAAGGGGAGAAGG + Intergenic
923878427 1:238075814-238075836 TTCTGGGAAGGAATTCAAGCAGG - Intergenic
923909217 1:238421181-238421203 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
1063271075 10:4510368-4510390 CCCAGGGGGGGAAGGCAAGAAGG + Intergenic
1063560584 10:7122729-7122751 CTATGCAAAGGAAGCCAAGAAGG + Intergenic
1063909419 10:10814264-10814286 CTCTGGGAAGAAAGGCAGCTGGG + Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065253105 10:23836916-23836938 CTGTGGGAAGGAAGGAAGGGAGG + Intronic
1065933501 10:30500026-30500048 AGCAGGGAAGGAAGGCAAGGAGG + Intergenic
1066391869 10:34983499-34983521 CTCTTTGAAGTAAAGCAAGATGG - Intergenic
1066466192 10:35652301-35652323 CTCTTGAAAGGAAGGAAGGAAGG - Intergenic
1067772055 10:49133743-49133765 CCCTGGGAAGGAAGCCCTGATGG - Intronic
1067783486 10:49226144-49226166 CTCTGCAAAGGAAGTCAACAGGG + Intergenic
1069247341 10:66222511-66222533 AGTTGGGAAGGAAGGAAAGAAGG + Intronic
1069372753 10:67764927-67764949 TTCTGGGATGGAAGGGAAGGTGG - Intergenic
1069843119 10:71352358-71352380 CTGTGAGAAGGTAGGCAGGAGGG + Intronic
1069893560 10:71666697-71666719 CTATGGGAGGGAAGGAAAAAGGG + Intronic
1070009223 10:72456017-72456039 TTCTGGGAAGGAAGGGAATGAGG + Intronic
1070694570 10:78552343-78552365 CTCTGGGAAGGAAGCCACCAGGG - Intergenic
1071149122 10:82612292-82612314 ATGAGGGAAGGAAGGCAAGATGG - Intronic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1072221265 10:93329567-93329589 CTCAGTGAAGGAAGGCACTAAGG + Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073091157 10:100940834-100940856 CTCATGGAAGGAAGGAAGGAAGG - Intronic
1073431618 10:103491037-103491059 CTTGGGGAAGGATGGCAGGAAGG + Intergenic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074858328 10:117490013-117490035 CTCTTGGAGGGGAGGCAGGAAGG + Intergenic
1074895472 10:117773567-117773589 CTTTAGGAAGGAAAGCAACAAGG + Intergenic
1074924464 10:118053253-118053275 CTGTTGGAAGGAAGGAAGGAAGG - Intergenic
1074974342 10:118568068-118568090 CTGTGGGAAGGAAGGAACAAAGG - Intergenic
1074978978 10:118603952-118603974 CTCTGGGCAGGAGGGCAGGCTGG - Intergenic
1075104072 10:119525532-119525554 CACTGGGAATGAAGGCAAAGAGG + Intronic
1075261650 10:120968509-120968531 CACTGGGGAGGAAGGAAAGCTGG - Intergenic
1075663419 10:124214085-124214107 CTCTTGGATGGAAGGGAGGAGGG - Intergenic
1075666272 10:124233254-124233276 GCGTGGGAAGGAAGGCAGGAAGG - Intergenic
1075784274 10:125038286-125038308 CTCTCGGAGGGAAGCGAAGATGG - Intronic
1076561092 10:131364738-131364760 CTCTGTGAAGGAAATCAAGGTGG - Intergenic
1076578674 10:131491700-131491722 TTTTGGCAAGGAAGGAAAGAAGG + Intergenic
1076725182 10:132409766-132409788 TGCTGAGAAGGAAGGGAAGAGGG + Intronic
1077424859 11:2470506-2470528 GCCTGGGAAGGAAGACAAGCCGG + Intronic
1078049385 11:7948519-7948541 CTGTGGAAGGGAAGGAAAGAAGG - Intergenic
1078356963 11:10639649-10639671 ATCTGGGCAGGGAGGCAAGCAGG - Intronic
1078462124 11:11522092-11522114 CCCTAGGAAGGAAGGAAGGAAGG + Intronic
1078597983 11:12705054-12705076 CTCTGGGAAGGAAAGAAGAATGG + Intronic
1079170160 11:18086158-18086180 CTCTGGAAGGCAAGGCAGGAAGG + Intronic
1079517652 11:21288044-21288066 ATAAGGGAAGGAAGGAAAGAAGG + Intronic
1079527685 11:21410395-21410417 CTCTGAGGAGGAAGGCGAGTAGG + Intronic
1079713138 11:23711056-23711078 CCTTGGGAAGGAAGGAAGGAAGG - Intergenic
1080946372 11:36979374-36979396 CTCAGGGAAGGAATTCAAGCAGG - Intergenic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1082004033 11:47409961-47409983 CTCTGGCAAGGACAGCAGGAGGG + Intronic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083611326 11:64005798-64005820 CCCTGAGAAGGCAGGCAGGAGGG + Intronic
1083682169 11:64356706-64356728 CTCTGGGAAGAAAGGAGAGCAGG + Intronic
1083743142 11:64721728-64721750 CACTGGGAAGGTAGACAACAGGG + Intronic
1083765106 11:64837980-64838002 CCCTGGGAAGGAGGGCAGAAGGG - Intronic
1084353179 11:68618366-68618388 CTCTGGGAAATAAGGCACGACGG - Intergenic
1084422090 11:69065567-69065589 GCCAGGGAAGGAAGGCAGGATGG - Intronic
1084573121 11:69971635-69971657 GTCTGGGAAGGAAGACAGGGAGG - Intergenic
1084868947 11:72082767-72082789 GGCTGGGAGGGAAGGCAGGAAGG - Intronic
1085214647 11:74818175-74818197 CCCTGGGAAGGAAAGGAAGAGGG + Intronic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1086894155 11:92293007-92293029 CTCTGCAAAGGAAGGAAGGAAGG + Intergenic
1087501191 11:98956082-98956104 CTATGGGAAGGAAGGAAGGATGG - Intergenic
1087597449 11:100272482-100272504 CTCTCAGAAGGAAGGAAGGAAGG + Intronic
1088063376 11:105685112-105685134 CTTTAGGAAGGAAGGAAAGAAGG + Intronic
1088400974 11:109422546-109422568 GTCTGGGAAGGACAGAAAGAAGG + Intronic
1088671969 11:112150556-112150578 CACAGGGAAGGAAGGGAAGACGG - Intronic
1088800791 11:113305308-113305330 ATCTCGGAAGGAAGGAAGGAAGG - Intergenic
1088971978 11:114781618-114781640 CATTGGGGAGGAAGGCGAGATGG + Intergenic
1089159890 11:116429274-116429296 CTCTGGCAAGGGAGGCAAGCTGG - Intergenic
1089411995 11:118252095-118252117 CTCTGGGAAGGAAGGAGGGAGGG - Intronic
1089528264 11:119110753-119110775 CTCTGGGATGGAATTCAGGAAGG + Intronic
1089539818 11:119183058-119183080 CTCTGAGAAGGAGGGCCCGAGGG - Intronic
1090061303 11:123466267-123466289 CTCTGTCAAGGAAGGAAGGAAGG + Intergenic
1090750173 11:129739716-129739738 CTCTGGGGAAGAAAACAAGAAGG - Intergenic
1091023282 11:132120072-132120094 GACTGGGAGGGAAGGCAAGCGGG - Intronic
1091366384 11:135024242-135024264 GTCTGGGAAGGAAGGAAAAATGG - Intergenic
1092258133 12:6938103-6938125 CAGAGGGAAGGAAGGAAAGAGGG - Intronic
1092328566 12:7560897-7560919 CTCTTGTAAGGTAGGCATGATGG - Intergenic
1092847420 12:12596642-12596664 CCCTGAGAAGGAAGGAAAGGGGG + Intergenic
1093796828 12:23322323-23322345 CTCATGGAAGGAAGGAAGGAAGG - Intergenic
1093996445 12:25647961-25647983 AGCAGGGAAGGAAGGAAAGAAGG - Intronic
1094471420 12:30804840-30804862 TTCTGGGGAGGAATTCAAGAAGG - Intergenic
1094526115 12:31232388-31232410 CTCGGAGGAGGGAGGCAAGAGGG - Intergenic
1094743380 12:33314919-33314941 TTCTGGAAAGGAATTCAAGACGG - Intergenic
1095982824 12:47982608-47982630 CCCTGGGGAGGGAGGTAAGAGGG + Exonic
1096021708 12:48330484-48330506 TTCTGGGGAGGAAGGCATGTTGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097343676 12:58467552-58467574 TTCTGGGAAGGAATTCAAGCTGG - Intergenic
1098442396 12:70532646-70532668 CCCTGTGAAGGACGGAAAGAGGG - Intronic
1099618061 12:84964356-84964378 CTCTGTGAGAGAAGGAAAGAGGG - Intergenic
1099771310 12:87061467-87061489 ATGGAGGAAGGAAGGCAAGAGGG + Intergenic
1100447508 12:94675206-94675228 GTCTGGGAGAGAAAGCAAGATGG - Intergenic
1101858608 12:108464488-108464510 CTCTGAGAAGAAAGGCAGGGAGG + Intergenic
1102220085 12:111188436-111188458 CTCTGTGAAGGAAGCCACCAGGG + Intronic
1102409452 12:112704599-112704621 CTCTGGGAAGAAAGAGATGATGG - Intronic
1102466283 12:113132627-113132649 CTCTGGGATGCCAGGAAAGAGGG + Intronic
1102599733 12:114020707-114020729 CTCTGGGAACAGAGACAAGAAGG + Intergenic
1102637168 12:114334485-114334507 CTCTGGGGAGGAACCCAAAAGGG + Intergenic
1102727992 12:115082380-115082402 CTCTTTGAAGGAAGCAAAGATGG - Intergenic
1102992061 12:117322539-117322561 GACAGGGAAGGAAGGAAAGAAGG - Intronic
1103054078 12:117804940-117804962 CTCTGGGCAGCAGGGAAAGATGG - Intronic
1103175116 12:118856347-118856369 CTATGGAAAAGAAGACAAGAAGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104436141 12:128758314-128758336 CCCCAGGAAGGAAGGCAAGGTGG - Intergenic
1104437461 12:128767252-128767274 ATAGGGGAAGGAAGGAAAGAAGG + Intergenic
1104572607 12:129938315-129938337 CCCTGGGAAGGAAGCAAAGAGGG - Intergenic
1104836733 12:131796457-131796479 CTCTGGGAAGCAAGGGGACAGGG + Intronic
1104996952 12:132664220-132664242 CACTGGGCAGGAAGGAAGGAGGG - Intronic
1104996963 12:132664259-132664281 CACTGGGCAGGAAGGAAGGAGGG - Intronic
1105219801 13:18314880-18314902 CTCTGGGAAGCAAAGCCAGGAGG - Intergenic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1105748552 13:23400096-23400118 ATCTGGGAAGGAAGGAAGGAAGG + Intronic
1106386162 13:29288225-29288247 CTCTGGGAATGGAGGCAATGGGG + Intronic
1106559103 13:30833430-30833452 CTCTGGGAAGGAAGGAAAAAAGG - Intergenic
1107285534 13:38786209-38786231 AGCTGGGAAGGGAGGAAAGATGG - Intronic
1108737867 13:53304579-53304601 CCCTGGGAGGGAAGCAAAGATGG - Intergenic
1108743897 13:53369949-53369971 CTGAGGGAAGGAAGGCTAGGTGG - Intergenic
1108802526 13:54116832-54116854 CTTTGGGACAGAAGGCATGATGG + Intergenic
1110343514 13:74419402-74419424 CCATGGGAAGGAAGGAAGGAAGG - Intergenic
1110591928 13:77273156-77273178 CTCAGGGAAAGATGGGAAGAAGG + Intronic
1110599053 13:77350680-77350702 ATCAGGGAAAGAAGGCTAGATGG + Intergenic
1111006388 13:82255346-82255368 CTGATGGAAGGAAGGCAAGAAGG + Intergenic
1111132653 13:83996949-83996971 CTCCAGGATGGAAAGCAAGATGG - Intergenic
1112434690 13:99383603-99383625 CCCTGGCTAGGAAGCCAAGAAGG - Intronic
1112982554 13:105403756-105403778 CTGTGGGAAGGAAAGCTGGAAGG + Intergenic
1113420755 13:110170018-110170040 GTCTGGGAAGGAAGGAAGGGAGG + Intronic
1113463664 13:110498841-110498863 CCCTGGGATGGAATGCAAGGAGG - Intronic
1113581346 13:111431976-111431998 ATCTTAAAAGGAAGGCAAGAAGG + Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1113760072 13:112840758-112840780 ATCCAGGAAGGAAGGCAAGGCGG + Intronic
1114577218 14:23726046-23726068 ATCAGGGGAGGAAGTCAAGAAGG - Intergenic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1118087304 14:62432264-62432286 TTATGGGAAGGAAGAAAAGATGG - Intergenic
1118138535 14:63053999-63054021 CTAAGGGAAGGAAGACAAGTTGG + Intronic
1118957073 14:70491963-70491985 TTCTGGAAAGAAAGTCAAGATGG - Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119216983 14:72876596-72876618 CTGAGGGAAGGAAGGCCAGATGG - Intronic
1119447133 14:74674865-74674887 GCCAGGGAAGGGAGGCAAGATGG + Intronic
1120133076 14:80829943-80829965 CAATGTGAAGGAAGGAAAGAAGG + Intronic
1120854860 14:89203523-89203545 CTCTGGGAAGGAGGGCATGGAGG + Intronic
1121313397 14:92947103-92947125 CTCTGTGATGGCAGGCAAGTGGG - Intronic
1121408646 14:93734502-93734524 CTCTAGGAAGACAGGCAAGCGGG - Intronic
1121482726 14:94291223-94291245 CTATAGGAAGGAAGGAAGGAAGG - Intronic
1121558744 14:94858401-94858423 CTCAGGGAAGGAAGGGACGGGGG + Intergenic
1121800156 14:96768512-96768534 GGCTGGGAAGGAAGGAAAGAAGG - Intergenic
1121800870 14:96773184-96773206 TTCAGGGAAGAAAGGCAGGAGGG - Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1122067853 14:99185946-99185968 ATCTGTGAAGGAAGGGAGGAAGG - Intronic
1122177966 14:99934983-99935005 CCCTGGGAAGAGAGGCAGGAAGG + Intronic
1122346044 14:101061007-101061029 CTCTGGGAAGCAAGGGGTGAAGG + Intergenic
1123047420 14:105525915-105525937 TTCTGGGAAGGAGGGCAGGCAGG + Intergenic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1124010919 15:25837900-25837922 CTCTTGGAAGGAAGGTATGCTGG + Intronic
1124940410 15:34212472-34212494 CTCTCAGAAGGAAGGAATGAAGG - Intergenic
1125334345 15:38613114-38613136 CCCTGGGAAGGAATGTTAGAGGG + Intergenic
1127327704 15:57911681-57911703 GTCTGGGCAGGAAGGCAGGGAGG + Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127545095 15:59986199-59986221 CCCTGAGAAGGAAGGAAGGAAGG + Intergenic
1128656981 15:69469760-69469782 CTCTGGGGAGCAAGGCATGCAGG - Intergenic
1128689767 15:69714562-69714584 CTCTCGGAGGGCAGGGAAGAGGG + Intergenic
1128721327 15:69952002-69952024 CTCTAGGAAGGAACACTAGAGGG + Intergenic
1129286648 15:74530896-74530918 CTATGGGATGGAGGGCCAGATGG + Intergenic
1130854153 15:87826195-87826217 CTCTGTGATGTGAGGCAAGATGG + Intergenic
1130884330 15:88080849-88080871 CATTGGGAAGGAAGGAAAGTGGG + Intronic
1131265960 15:90915567-90915589 CTCTGGAAAGGACAGCCAGATGG - Intronic
1131552810 15:93372629-93372651 CTCCGAGAAGGAAAGCAACACGG - Intergenic
1132110673 15:99099968-99099990 CTCTGGGAAGTAGGGCACAAGGG + Intronic
1132291632 15:100707669-100707691 CACTGGGTAGGAATGCAAAATGG + Intergenic
1132298802 15:100763900-100763922 CCCTTGGGAGGAAGGCACGAGGG - Intergenic
1133594818 16:7281003-7281025 GTCTCGGAAGGAAGGAAGGAAGG - Intronic
1134013401 16:10871698-10871720 CTCAGGAAAGGAAGCCCAGAAGG - Intergenic
1135023296 16:18980277-18980299 CTCCAGTAAGGAAGGGAAGAGGG + Intergenic
1135074886 16:19384728-19384750 CTCCAGTAAGGAAGGGAAGAGGG - Intergenic
1135393813 16:22115828-22115850 CCCAGGGAAGGAAGGAAGGAAGG + Intronic
1135707173 16:24685032-24685054 CTCTTGGAAGAACTGCAAGAAGG - Intergenic
1135784448 16:25336075-25336097 GGCTGGGAAGGAAGGAAGGAAGG - Intergenic
1135943086 16:26839856-26839878 CTCTGGGAAGTTAGGGCAGAGGG + Intergenic
1137055132 16:35742051-35742073 CTCTGCCCAGGAAGGAAAGAAGG + Intergenic
1137067439 16:35863173-35863195 CTTTGGGAAGCTAGGCAAAATGG + Intergenic
1137539669 16:49353634-49353656 GTCTGGGAAAGCAGGCATGATGG + Intergenic
1137581842 16:49638371-49638393 GTCGGAGAAGGAAGCCAAGAAGG - Exonic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1137721755 16:50631638-50631660 GTGTGGGAAGGAAGCCAGGAGGG + Intronic
1137853309 16:51767918-51767940 AGCTGGGAATGAAGGCCAGAAGG - Intergenic
1138139147 16:54552167-54552189 CTCTGGGGAGGGAAACAAGATGG - Intergenic
1138165895 16:54801294-54801316 CTCTGGGGAGAAATGCCAGATGG - Intergenic
1138825682 16:60316488-60316510 CTCTGAGAAGGAAGGGAGGAAGG - Intergenic
1140067454 16:71623916-71623938 CTCTGGGAAGAAAGGCTTCAGGG + Intergenic
1140194459 16:72845212-72845234 GTCTGGAAGGGAAGGAAAGAAGG + Intronic
1140436548 16:74951542-74951564 CTCTGAAAAGAAAGGAAAGAAGG + Exonic
1141161268 16:81630626-81630648 CTCCGAGAAGGAAGGCAGAATGG + Intronic
1141508605 16:84497511-84497533 CTCTGGGAGGGCAGTCAGGAGGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1141950675 16:87337331-87337353 CTCTTGGAATGAGGCCAAGATGG - Intronic
1142320148 16:89376831-89376853 CACTGGGATAGAAGGCAAGAAGG + Intronic
1143204728 17:5133778-5133800 CTTCGGGAAGGAAGGAAAGAAGG - Intronic
1144351589 17:14402386-14402408 TTCTGGGAAGGAATTCAAGCTGG + Intergenic
1144482376 17:15638692-15638714 CCCTGGCAAGGAAGGAGAGAGGG + Intronic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1144916307 17:18726340-18726362 CCCTGGCAAGGAAGGAGAGAGGG - Intronic
1145037819 17:19553445-19553467 ATGTGGGAGGGAAGGAAAGATGG - Intronic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1145984224 17:29033727-29033749 ATCTGGGGAGGAAGGCATGAAGG + Intronic
1146160452 17:30556764-30556786 CTTCGGGAAGGAAGGAAAGAAGG - Intergenic
1146285052 17:31568669-31568691 CTTGGGGTAAGAAGGCAAGAGGG - Intergenic
1146676746 17:34779010-34779032 ATCTGAGAAGCAAGGCTAGAGGG + Intergenic
1146843943 17:36172051-36172073 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146856249 17:36259986-36260008 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146864370 17:36328389-36328411 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1146872156 17:36383897-36383919 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146879518 17:36434982-36435004 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146883445 17:36456125-36456147 CTTTGGGAAGGAAGGACAGAAGG + Intergenic
1147067229 17:37928977-37928999 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1147075042 17:37984521-37984543 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1147078761 17:38008538-38008560 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1147086567 17:38064067-38064089 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1147094699 17:38132473-38132495 CTTCGGGAAGGAAGGACAGAAGG - Intergenic
1147102510 17:38188030-38188052 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147341979 17:39758031-39758053 CACTGGGAGGGAAGGCGGGAGGG - Intergenic
1147599492 17:41737023-41737045 CTGTCGGAAGGAAGGAAGGAAGG + Intergenic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148393501 17:47290443-47290465 TTCTGAGAAGGAAGGAAGGAAGG + Intronic
1148465575 17:47863123-47863145 CTCTGGGCAGGAAAGGAGGATGG + Intergenic
1148797716 17:50205091-50205113 CCCTGGAAAGGAAGGAAGGAGGG - Intergenic
1148878762 17:50708789-50708811 CCCTGGGGAGGAAGGGAGGAAGG + Intergenic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1149534671 17:57423664-57423686 CTGAGGGAGGGAAGTCAAGAAGG - Intronic
1149847083 17:60014496-60014518 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1150085442 17:62271113-62271135 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1150099891 17:62413864-62413886 TTCTGGGAAGGAACTCAACAAGG - Intronic
1150169756 17:62980944-62980966 CTCAGGGAGAGAAGTCAAGAGGG - Intergenic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1150649026 17:66997915-66997937 CCCTGAGAAGGAAGGGAAGGAGG + Intronic
1150711140 17:67531800-67531822 CTCTAGGAAGGATGGCAGCAGGG + Intronic
1151044941 17:70908906-70908928 CCCTGGGAGGGAAGGAAGGAAGG - Intergenic
1151115177 17:71727513-71727535 AGGTGGGAAGGAAGGAAAGAAGG - Intergenic
1151126112 17:71846475-71846497 CCCTGGGAAGCAAAGAAAGACGG + Intergenic
1151356184 17:73559966-73559988 CCCTGGGAGGGATGGCATGAAGG + Intronic
1151391610 17:73791065-73791087 CACTGGGAAGGGACACAAGAAGG + Intergenic
1151516232 17:74597953-74597975 AACTGGGAAGGAAGGAAGGAAGG + Intergenic
1152296804 17:79472139-79472161 CTCTGGGATGGAGGCCAAGTGGG - Intronic
1152631240 17:81411555-81411577 CTCAAGGAAGGAAGGAAGGAAGG - Intronic
1152645579 17:81467114-81467136 CTGTGGCAAGAAAGGAAAGACGG + Intergenic
1152764621 17:82129296-82129318 CTGTGGAAAGGAAGCCAAAAGGG + Intronic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153014818 18:573968-573990 ATCTGGGAAAGAAGGGGAGAGGG + Intergenic
1153764080 18:8358721-8358743 GTCTGGCAGGGAAGGCAACATGG - Intronic
1153786828 18:8543114-8543136 CTGTCGGAAGGAAGGAAGGAAGG + Intergenic
1153912636 18:9717629-9717651 CTCTGGGAGGGAAGGACAGAGGG + Intronic
1154185756 18:12181634-12181656 CTCTGGGGGAGAAGCCAAGATGG + Intergenic
1154506201 18:15043159-15043181 CTAAGGGAAAGAAGGCAAGGTGG - Intergenic
1156203996 18:34866027-34866049 CAGTGTGAAGGAACGCAAGATGG - Intronic
1156377948 18:36531509-36531531 ATTTAGGAAGGGAGGCAAGATGG - Intronic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157390192 18:47295375-47295397 CTCTGGGGAGGAAGAAAGGAAGG - Intergenic
1157482365 18:48063496-48063518 AACTGGGAAGAAAGGCAGGAGGG + Intronic
1157499465 18:48179687-48179709 CGCAGGGAAGGAAGGAAGGAAGG - Intronic
1157553460 18:48597320-48597342 CCCTGGGAAGGAAGGCATGCAGG + Intronic
1157866337 18:51188622-51188644 TGCTGGGAATAAAGGCAAGAGGG + Intronic
1158376473 18:56875465-56875487 CAGTGGGAAGGTATGCAAGATGG - Intronic
1158439652 18:57463482-57463504 CTCTTGAAAGGAAGGAAAGAAGG + Intronic
1159387465 18:67743963-67743985 CTCTTGAAAGGTAGGCATGATGG - Intergenic
1160255849 18:77248676-77248698 CTCAGGGAAGAAAAGCAATACGG + Intergenic
1160306796 18:77747565-77747587 CTGCGGGAAAGAAGGAAAGAGGG - Intergenic
1160914289 19:1489518-1489540 CTCTGGTAAGGAGGGACAGACGG - Intronic
1161136784 19:2624743-2624765 TTCTGGGAAGGAGGGAAGGAGGG + Intronic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162187941 19:8921861-8921883 CCCTGGGAAGGAAAGGAAGCTGG + Intronic
1163268430 19:16234992-16235014 TGCCGGGAAGGAAGACAAGAAGG - Exonic
1163363866 19:16865387-16865409 CTATGGAAAGGAAGGCAGGACGG - Intronic
1163388648 19:17015914-17015936 CACAGGGAGAGAAGGCAAGAAGG + Intronic
1164670498 19:30069605-30069627 CTCAGGGAAGGAATGAAGGAAGG + Intergenic
1165189328 19:34049337-34049359 CTCCAGGAAGGAAGGAAAGAAGG + Intergenic
1165984962 19:39760084-39760106 CTGTGGGTAGGAATGCAAAATGG + Intergenic
1166348821 19:42184341-42184363 TTCTGGGAAGGGCGGCAGGAAGG - Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166739441 19:45105097-45105119 CTCTGGGCAGGAGCGCAATATGG + Intronic
1166930951 19:46301026-46301048 CTCTGGGCAGGAAGACAAACAGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167554234 19:50183184-50183206 CTGTCGGAAGGAAGGAAGGAAGG - Intergenic
1168541044 19:57210671-57210693 CTCTGGAAAGGATGGCACGCTGG - Intronic
925380261 2:3419900-3419922 CACTGCTAGGGAAGGCAAGATGG + Intronic
925899774 2:8500433-8500455 CACAGGGAGGGAAGGCAAGGAGG + Intergenic
925964014 2:9046251-9046273 CTTTGAGAAGGAAGGAAGGAAGG - Intergenic
926113341 2:10196325-10196347 GCCATGGAAGGAAGGCAAGAAGG - Intronic
926130080 2:10297420-10297442 GTCAGGGAAGCAGGGCAAGAGGG + Intergenic
926180156 2:10635616-10635638 CGCTGTGAAGGAAGGCAGCAGGG - Intronic
926500171 2:13643679-13643701 TTCTGGGAAGGAATTCAAGCTGG + Intergenic
926933241 2:18061558-18061580 GTGAGGGAAGGAAGGAAAGAAGG + Intronic
927090679 2:19708547-19708569 CACCAGGAAGGAAGGAAAGAGGG + Intergenic
927621017 2:24658887-24658909 CTGGGGGAAGGAAGACAACATGG - Intronic
928183673 2:29090252-29090274 GTCTCGGAAGGAAGGAAGGAAGG - Intergenic
928312603 2:30223085-30223107 CCCTTGGAAGGAAGGAAGGAAGG + Intergenic
929008502 2:37418298-37418320 GTCTGGGAAGGAAGGAAGGTGGG + Intergenic
929342221 2:40834302-40834324 CTTTAGGAAGGAAGGAAGGAGGG - Intergenic
929628638 2:43435447-43435469 CTCCTGGAAGGAAGGGAGGAAGG + Intronic
929904897 2:46037023-46037045 CTGTGGGAAGGCAGGCGAGGAGG - Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
932430654 2:71672013-71672035 CACTGGGAGGGAAGGCCAGAGGG + Intronic
933721602 2:85400801-85400823 CTCTGGGGAGGCAGCCAAGATGG - Intronic
934184246 2:89657637-89657659 CTCTGGGAAGCAAAGCCAGGAGG + Intergenic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934294535 2:91731775-91731797 CTCTGGGAAGCAAAGCCAGGAGG + Intergenic
935020437 2:99225192-99225214 ATCTGGGAAGGAAGGAAGGAAGG + Intronic
935066009 2:99648727-99648749 AACTGGGAAGGAAGGCAGGGTGG + Intronic
936018836 2:108979636-108979658 CCCTGGGTAGGGAGGCAGGAGGG - Intronic
936028112 2:109049297-109049319 GTGCGGGAAGGAAGACAAGACGG - Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936821726 2:116530139-116530161 TTCTGGGAAGGAATTCAAGCTGG + Intergenic
936846365 2:116839918-116839940 TTCTAGGAGGGAAGGAAAGAGGG + Intergenic
936963110 2:118097813-118097835 CTCTTGGATGGAAGCCAAGAAGG - Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937257881 2:120567561-120567583 CACTGGGAAGGAAGGAAAATTGG + Intergenic
937364208 2:121249086-121249108 CTCTGGGGAGGGAGGCCAGCAGG + Exonic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937400867 2:121582472-121582494 TTTTTGGAAGGAAGGAAAGAAGG + Intronic
937888244 2:126915195-126915217 CTCCAAGAAGGAAGGCAAGAGGG + Intergenic
937901100 2:127019778-127019800 CTCTGGGAGGGAAGAGAAGGAGG + Intergenic
938410388 2:131059028-131059050 CTCAGGGAAGAAATGCAAAAAGG + Intronic
938472973 2:131582789-131582811 CTTTGAGAAGAAAAGCAAGATGG + Intergenic
938823172 2:134978833-134978855 CTTTGGGAAGGCAGGTCAGATGG - Intronic
938878508 2:135559431-135559453 ATCTAGCAAGGAATGCAAGAAGG - Intronic
939185228 2:138852806-138852828 TCATGGGAAGGAGGGCAAGAGGG + Intergenic
939623194 2:144446054-144446076 TTCAGGGAAGGAAGGAAGGAAGG - Intronic
939712808 2:145543937-145543959 CACTGGGAAGGAAGGAAGGAAGG - Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940749230 2:157605952-157605974 AGCTGGGAAGGAGGGAAAGAGGG - Intronic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
941339294 2:164286939-164286961 ATGAGGGAAGGAAGGAAAGAGGG + Intergenic
941882922 2:170499966-170499988 CTAAAGGAAGGAAGGAAAGAAGG - Intronic
942360651 2:175168277-175168299 CCCTCAGAAGGAAGGCAAGAAGG - Intronic
942615263 2:177785392-177785414 TTCTGGGAGGGCAGCCAAGATGG + Intronic
942715389 2:178885916-178885938 CTCTGGGAAGGAAGGAAGCGGGG + Intronic
942717391 2:178908691-178908713 CTTAAGGAAGAAAGGCAAGAAGG - Intronic
942893611 2:181021663-181021685 AGTTGGGAAGGAAGGAAAGAAGG - Intronic
943490737 2:188552969-188552991 AGCTGAGAAGGAAAGCAAGAAGG - Intronic
943836496 2:192520818-192520840 TTCTAGGAATCAAGGCAAGAAGG - Intergenic
944177634 2:196850635-196850657 CTCTTGGAAGGAAGGAGGGAAGG + Intronic
944450630 2:199838634-199838656 CTTTGGGAGGGAAGGCAAAGGGG + Intronic
944727292 2:202484363-202484385 TTTTCGGAAGGAAGGAAAGAAGG - Intronic
945058703 2:205889859-205889881 CTCAAGGAAGGAAGGAAGGAAGG + Intergenic
945559554 2:211321923-211321945 CTCTGCAAATGAAGGCAACAGGG - Intergenic
945986990 2:216362937-216362959 TGCTGGGAAGGAAGCCAAGTTGG - Intronic
946316605 2:218919446-218919468 CTCTGGAAAGAAAGAAAAGAAGG - Intergenic
946371764 2:219285584-219285606 CTCGGGGAAGGAAGGAAGAAGGG - Exonic
946409606 2:219509532-219509554 CTCAGGGAAGGAAGGGGAGCAGG - Intergenic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
946934700 2:224708019-224708041 CTCTAAGAAGGAAGGAAGGAAGG - Intergenic
946967752 2:225055800-225055822 AGCTGGGAAGCAAGGCAGGAAGG + Intergenic
947946162 2:234104238-234104260 CTATAGGAAGGAAAGCCAGATGG + Intergenic
947996678 2:234533835-234533857 CTTTGGTGAGGAAGGAAAGATGG + Intergenic
948161362 2:235827594-235827616 CCCTTGGAAGGAAGGGGAGAGGG + Intronic
948188244 2:236038268-236038290 TTCTGAGAAGGAAGGCAGGGAGG + Intronic
948839091 2:240640585-240640607 GTCAGGGAAGGAAGGAGAGAGGG - Intergenic
948875358 2:240824076-240824098 CTCTGGGGAGGGAGGCAGCAAGG - Intergenic
1169362237 20:4960722-4960744 CTCTGGGAAGAAGAGAAAGAGGG + Intronic
1169748238 20:8964676-8964698 CTGTGGCAAGGAAGGAAGGAAGG + Intronic
1170119053 20:12892697-12892719 CTCTGGGAAGGAAGGGACCATGG - Intergenic
1170396181 20:15927840-15927862 CTTTAGGAAGAAAGGAAAGAAGG - Intronic
1170426175 20:16237484-16237506 TCCTGGGAAGGAAAGCAGGAGGG + Intergenic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1172104846 20:32510791-32510813 GTGTGGGAAGGCAGGCGAGAGGG + Intronic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172758379 20:37304403-37304425 ATGTGGGAAGGAAGGGAATAGGG - Intronic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1173367558 20:42400926-42400948 TACTGGGAAGGAAGGAAGGAAGG + Intronic
1173530880 20:43768622-43768644 CTATGGGAGGGGAGGCATGAGGG - Intergenic
1173607122 20:44339294-44339316 CTCAGGGTAGCAAGGCAACAAGG - Intronic
1173752690 20:45489373-45489395 CTCTGGGAATGTAGCCAAGCAGG + Intergenic
1174300312 20:49577235-49577257 CTCTGTGAAGGAGGACAATAAGG + Intergenic
1174577499 20:51546979-51547001 CTCAGGGAAGGATGAGAAGATGG + Intronic
1174742761 20:53031892-53031914 ATTAGGGAAGGAAGGAAAGAAGG + Intronic
1175384396 20:58584871-58584893 CACTCGGAAGGAAGGAAGGAAGG - Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175666357 20:60863614-60863636 TTTTAGGAAGGAAGGAAAGAAGG + Intergenic
1175918951 20:62441079-62441101 CTCTGGGAGGGAAGCCATGGAGG + Intergenic
1176060646 20:63171300-63171322 CTCTGGGAAAGCAGGCAGGGTGG - Intergenic
1176791652 21:13325864-13325886 CTAAGGGAAAGAAGGCAAGGTGG + Intergenic
1177376298 21:20274537-20274559 GTCTGGGAAGGAGGGAAGGAAGG + Intergenic
1177990126 21:28027452-28027474 CTAAGGGAAAGAAGGCAAGGTGG - Intergenic
1178155026 21:29842869-29842891 CTCTGGAAAGGAAGCCTATAGGG - Intronic
1178386328 21:32153633-32153655 ATTTGGGAAGGAAGGAAGGAAGG + Intergenic
1179089864 21:38255229-38255251 CTCAGTGAATGAAGGCCAGAGGG + Intronic
1179141144 21:38726549-38726571 GTCAGGGAAGGAAGGAAGGAAGG - Intergenic
1179567246 21:42256906-42256928 ATGTGAGAAGGACGGCAAGAGGG - Intronic
1179922927 21:44516864-44516886 CTCTGGGAAGGAAGGAGGGGAGG - Intronic
1180043229 21:45291244-45291266 CTTTGGGACAGACGGCAAGATGG + Intergenic
1180252307 21:46597574-46597596 CTCTGGGGAGGAATGCAGGTGGG + Intergenic
1180817407 22:18799771-18799793 CTCTGGGAAGCAAAGCCAGGAGG - Intergenic
1181203597 22:21234092-21234114 CTCTGGGAAGCAAAGCCAGGAGG - Intergenic
1181368926 22:22401137-22401159 ATCTGGAAAGGAAGGCAGGGAGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1182062656 22:27408810-27408832 CTCTGGGAAGGAAGGCCACCAGG + Intergenic
1182558954 22:31143915-31143937 ATCTGGGGAGGAAGCCCAGAAGG + Intergenic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1183307300 22:37089549-37089571 CCCTGGGAAGGAGGGCAGGAGGG - Intronic
1183541028 22:38429568-38429590 GTGTGGGAAGGAAGGCAGGAGGG - Intronic
1183678640 22:39313823-39313845 TTCTCAGAAGGAAGGCAACAAGG + Intronic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1203223324 22_KI270731v1_random:61322-61344 CTCTGGGAAGCAAAGCCAGGAGG + Intergenic
1203267505 22_KI270734v1_random:25498-25520 CTCTGGGAAGCAAAGCCAGGAGG - Intergenic
949275143 3:2270547-2270569 CTCTGAGAATGAAGGAAAGTAGG - Intronic
949680527 3:6508230-6508252 AACTGAGAAGGAAGGAAAGAAGG - Intergenic
950739480 3:15038708-15038730 GGCTGGGAAGGAAGACAAAAAGG - Intronic
950829334 3:15859322-15859344 GTCCGGGAAGGAAGGGAAGCAGG - Intronic
950895889 3:16450408-16450430 CTCAGAGAAGGAAGGCAGGTAGG + Intronic
952151144 3:30593904-30593926 GTCTGGAAAGGAAAGAAAGAGGG - Intergenic
952532462 3:34276165-34276187 ATCCGGGAAGGAAGGAAGGAAGG - Intergenic
952548768 3:34451106-34451128 GTCTGGGGAGGGAGCCAAGATGG - Intergenic
953998043 3:47535904-47535926 CCCTTGGAAGGAAGGAAGGAAGG - Intergenic
954296170 3:49675542-49675564 CTCAGGGAGGAAAGGCAAGGTGG + Intronic
954336824 3:49923323-49923345 CTCTGGGAGGGAAGGAAGGGAGG + Intronic
954370201 3:50166149-50166171 GTCCGGGTAGGAAGCCAAGAGGG - Intronic
954393189 3:50278231-50278253 CACTGGGAAGGAAGGGCACAGGG + Intergenic
954656115 3:52195267-52195289 CTCTGAGAAGGAAGGGAGGGAGG + Intergenic
954748727 3:52802020-52802042 CTGTTGGAATGAAAGCAAGAAGG - Intronic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955072485 3:55583576-55583598 TTCTAGGAAGGAAGGAAGGAAGG - Intronic
955694032 3:61617639-61617661 CTCTGGCAAGGAAGGCAAGAGGG - Intronic
956137281 3:66111574-66111596 CGTTTGGAAGGAAGGAAAGAAGG - Intergenic
956349322 3:68317377-68317399 ATTTAGGAAGGAAGGCAACATGG - Intronic
956546627 3:70410186-70410208 GTCTGGGAAGGAAGGCAACATGG - Intergenic
956584452 3:70849603-70849625 CTCTAGGAAGCAAGCAAAGAAGG - Intergenic
956786408 3:72646285-72646307 CTCAGGGAAGGGAGATAAGAAGG + Intergenic
956916543 3:73877903-73877925 ATGTGGGAAGGAAGGAAATATGG + Intergenic
957983964 3:87548406-87548428 ATATGGGAAGGAAGGAAGGAAGG + Intergenic
958617757 3:96517178-96517200 AGCTGGGAAGGAAAGAAAGAAGG + Intergenic
958790919 3:98650119-98650141 CTAAGGGAAAGAAGCCAAGATGG - Intergenic
958958679 3:100488577-100488599 CTCTGGGGAGGAAGGCTCTAAGG + Intergenic
959027559 3:101257928-101257950 CTCTGGGAAGGAGGAGAGGATGG - Intronic
959284935 3:104396917-104396939 GAGAGGGAAGGAAGGCAAGAAGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960052278 3:113250385-113250407 CTCTGGGAACAAAGGCAGGTTGG + Intronic
960721029 3:120624545-120624567 CTCTGAGAAAGAAAGAAAGAAGG + Intergenic
960825869 3:121783795-121783817 ACCTGAGAAGGAAGGCAACATGG - Intronic
961414517 3:126747752-126747774 CTCTGGAAATGAAGGGAAGGAGG - Intronic
961985832 3:131133310-131133332 CTTGGGGAAGGAAGGAAGGAAGG + Intronic
962251911 3:133840826-133840848 CCCTGGGAAGGTAGGCAAGGGGG - Intronic
962350950 3:134655270-134655292 ATATGAGAAGGAAGGCAACACGG - Intronic
962416076 3:135183275-135183297 CTCCAGGAAGGAAGGAAGGAAGG - Intronic
963258468 3:143169792-143169814 CACTGGGGAGAAAGGCATGATGG - Intergenic
963294736 3:143533327-143533349 ATCTGGGAATTAAGGCAAGTAGG - Intronic
963399827 3:144784046-144784068 TTCTAGGATGGAAGGGAAGAAGG + Intergenic
963788218 3:149556679-149556701 CTTTGGGAAGGAAAGGAATAAGG + Intronic
963901983 3:150741799-150741821 ATATGGGAAGGCAGGCAGGAAGG + Exonic
963974076 3:151461044-151461066 CTCTGGGAGGGAAGGAAGGAAGG + Intergenic
965034140 3:163414386-163414408 TTCTGGGAAGGAAGACTAGGAGG - Intergenic
965117696 3:164513547-164513569 CTCAGGGAAGCAAGGCAAAATGG - Intergenic
965353832 3:167649129-167649151 GCCTGGGTAGAAAGGCAAGAAGG + Intronic
966640440 3:182183700-182183722 CACTGGGGAGGAAGGAAGGAAGG - Intergenic
966878516 3:184336802-184336824 CTGTGGGAAGGAAGCCCTGATGG - Intronic
966926928 3:184650605-184650627 CTCCGGGGAGCAAGGCCAGAGGG + Intronic
967894811 3:194387346-194387368 CTCTCAGGACGAAGGCAAGAGGG - Intergenic
968876694 4:3272137-3272159 CTCACGGAAGGAAGGAAGGAAGG - Intergenic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970444155 4:16110128-16110150 CTCTGTCAAGGAAGGAAGGAAGG + Intergenic
970581512 4:17477908-17477930 CTCTGGTTAGGGAGGCATGACGG - Intronic
970665823 4:18334939-18334961 TTCTGGGAAGGAATTCAAGCTGG + Intergenic
970695676 4:18674099-18674121 TTCTGGGAATTAAGGCAAGATGG + Intergenic
970944015 4:21669136-21669158 GTCTTGGAAGGAAGGAAGGAAGG - Intronic
971302696 4:25455081-25455103 CTCCAGGAAAGAAGGCAAGGAGG + Intergenic
973016284 4:45142821-45142843 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973016298 4:45142884-45142906 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973608752 4:52613211-52613233 CACTGGAAAGAAAGGAAAGAGGG + Intronic
973613101 4:52656400-52656422 CTCTGGGAAGGAAGACTGGGAGG + Intronic
973827943 4:54727800-54727822 CTGTAGGAAGGAAGACAACAAGG - Intronic
973907858 4:55548324-55548346 TTCTGAGAAAGAAGGCAACACGG + Intergenic
974375578 4:61071859-61071881 CTCTGGGAAGCCAGGCAGTAGGG - Intergenic
974923507 4:68270577-68270599 TTCTGGGAAGGAATTCAAGCTGG - Intergenic
976068455 4:81215588-81215610 CTCTGGGAGGGAAGGCGAAGTGG - Intergenic
976089944 4:81446750-81446772 CTTTTGGAAGGAAGGAAAGAGGG - Intronic
976454646 4:85232205-85232227 TTCTTGGAAGGAAGGAAAGAAGG - Intergenic
978415683 4:108473603-108473625 CTCTGGGTAGGAAGGCAAGGGGG + Intergenic
978647252 4:110950548-110950570 CTTTTGGAAAGAAGGCATGATGG + Intergenic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
979069944 4:116189530-116189552 CTCTGGGAAATAAGGCCAGTAGG + Intergenic
979340018 4:119511672-119511694 CCCTTGGAAGGAAGGAAGGAAGG + Intronic
980706782 4:136507464-136507486 TTCTCAGAAGGAGGGCAAGACGG - Intergenic
981495743 4:145390494-145390516 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
981563040 4:146067692-146067714 CTGTGAGAAGGAAGGAGAGAAGG - Intergenic
982194791 4:152900106-152900128 CTCTTGGAAGGAAGGAAGGAAGG + Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982805199 4:159754835-159754857 TTCTGGGAAGGAATTCAAGCTGG + Intergenic
983497622 4:168461097-168461119 CTCTGGGAAGGAGAGTAAGAGGG - Intronic
984364531 4:178781449-178781471 ATTTGGGAAGGAAGGAAGGAAGG + Intergenic
985607645 5:866912-866934 TTCTGGGGAGGAATTCAAGAAGG + Intronic
985758494 5:1733122-1733144 CTCTGGGAATGAAGGCTGGGAGG - Intergenic
986091884 5:4516838-4516860 AACTGAGAAGGAAGGAAAGAAGG - Intergenic
987330410 5:16852092-16852114 CACTGGGAAGGAAAGAAGGAAGG + Intronic
988123154 5:26993624-26993646 ATATGGGAAGGAATGAAAGAAGG + Intronic
990209386 5:53466106-53466128 CTTTGAGAAGGAAGGCAGGTAGG - Intergenic
990631447 5:57674689-57674711 CCCTGGGAAGGAAGGAAGGGAGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991516413 5:67440804-67440826 CTCTGACAAGGAAGGAAACAAGG - Intergenic
991679817 5:69127680-69127702 CTCTGAGTAGGAAGGCAAATGGG - Intronic
992483844 5:77176975-77176997 CAAAGGGAAGGAAGGAAAGAAGG - Intergenic
994017837 5:94989216-94989238 CTCTCAGAAGAAAGGCACGATGG - Intronic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
996452384 5:123640364-123640386 ATCTGAGAAGGAAGGCCAGTCGG - Intergenic
996524716 5:124466476-124466498 CAATGGGATGGAAGGCCAGAAGG + Intergenic
996652200 5:125892629-125892651 CTATGGGAAGGAAAGGAAAAAGG + Intergenic
997267824 5:132506659-132506681 CTCTTGGAATGAATGGAAGATGG + Intergenic
997379213 5:133423399-133423421 CTCTTGGAAGGAGGGCAGGAAGG - Intronic
997468772 5:134105029-134105051 CTCTCGGGAGGTAGGCTAGATGG - Intergenic
997809990 5:136957643-136957665 CTATGAGTAGCAAGGCAAGAGGG + Intergenic
998152853 5:139766997-139767019 CTCTGAGAAAGAAAGAAAGAAGG - Intergenic
998292004 5:140925076-140925098 ATCTGGAAAGGAAGGAAGGAAGG + Intronic
998552807 5:143093794-143093816 CTCTGAGAAGAAAGGAAAGGGGG + Intronic
999119109 5:149195410-149195432 CACAGGGATGGAAGGCAAGCTGG - Intronic
999227543 5:150039037-150039059 TTGTGGGAAGGAATGCAAAATGG - Intronic
999243736 5:150142169-150142191 CTTAGGGAAGGAAAGCAAGAGGG + Intronic
999432757 5:151538309-151538331 TTTGGAGAAGGAAGGCAAGATGG + Intronic
1000989683 5:167898983-167899005 TTCAGGGAAGAGAGGCAAGAGGG + Intronic
1001092120 5:168749414-168749436 CCCTGGGAAGGCAAGGAAGATGG - Intronic
1001125351 5:169014085-169014107 TTGTGGGAAGGAAGGCAGGCAGG + Intronic
1002342143 5:178524237-178524259 CCCTGGGAATGAAGCCAACATGG - Intronic
1002466514 5:179411440-179411462 CTCTGGGAGGGCAGGCAGGCTGG + Intergenic
1002852947 6:1012473-1012495 CTTTGGGATGGAAGACAAGCAGG - Intergenic
1002920067 6:1561967-1561989 CTCTGAAAAGGAAAGCATGAGGG - Intergenic
1003644689 6:7904999-7905021 CTCTGGGATAGAAGTCAAGCGGG - Intronic
1003865604 6:10359810-10359832 CCCTAGGAAGGAAGGAAGGAAGG - Intergenic
1004394990 6:15239800-15239822 CTCTGGTAAAGCAGCCAAGACGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005180445 6:23098372-23098394 CTCTGACAAGGAAGGAAAAAGGG - Intergenic
1005394160 6:25364185-25364207 CTCTGGGAGGCCAGGCAGGAGGG - Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1006193487 6:32223336-32223358 CTCTCGGAAGCAAGACAACAGGG + Intronic
1006650167 6:35544946-35544968 GTCAGGGAAGGAGGGCAGGAGGG + Intergenic
1007134831 6:39510511-39510533 CTCTGGTAAGGAAGGCTTGGTGG - Intronic
1007176500 6:39901378-39901400 CTCTGAGAAGGCCTGCAAGAAGG - Exonic
1007834663 6:44665308-44665330 GTCTGGGAAGGAAGGGGAGGAGG - Intergenic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008631864 6:53369753-53369775 TTCTTGTAAGGAGGGCAAGAAGG + Intergenic
1008631868 6:53369786-53369808 TTCTTGTAAGGAGGGCAAGAAGG + Intergenic
1009942467 6:70305001-70305023 CTCTGGTAAGAAAGGAGAGAGGG + Intergenic
1010248852 6:73687494-73687516 ATCAAGGAAGGAAGGAAAGAAGG - Intergenic
1010507260 6:76675656-76675678 CGCAGGGAAGGAAGGAAGGAGGG - Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011550504 6:88527482-88527504 CTGAGGGAGGGAAGGAAAGAAGG + Intergenic
1011602672 6:89074568-89074590 CTCAGGTAAGGAAGGCATAATGG + Intergenic
1013309668 6:108881321-108881343 CTGTTGGAAGGAAGGAAGGAAGG - Intronic
1013428777 6:110037711-110037733 CTCTGGGGAGGAGGGAAGGAGGG + Intergenic
1013582354 6:111548780-111548802 CTGTGGGATAGAAAGCAAGAAGG + Intergenic
1013838541 6:114362021-114362043 CTCTGAGAAGGAAGGAAGGAGGG - Intergenic
1013968115 6:115980841-115980863 CTCTGGCAGGTAAGGCAAAAAGG - Intronic
1014495692 6:122119172-122119194 CAAGGGGAAGGAAGGAAAGAAGG + Intergenic
1014532737 6:122578578-122578600 AAATGGGAAGGAAGGAAAGATGG - Intronic
1014680859 6:124428694-124428716 CTCTGGAAAAGATAGCAAGAAGG + Intronic
1015105232 6:129528667-129528689 CAATGGGAAGGAAGCAAAGATGG - Intergenic
1015387170 6:132637084-132637106 CTCTTGTAAGGAAGGCCTGATGG - Intergenic
1015513342 6:134060890-134060912 CAGTGGGAGGGAAGGCAGGATGG + Intergenic
1017114993 6:150967877-150967899 CTCTAAGTAGGAAGGCAACAGGG - Intronic
1018026885 6:159813822-159813844 CTTTGGAAACGGAGGCAAGAGGG - Intronic
1018274103 6:162111602-162111624 GTGTGAGAAGGAAGGCAAGTGGG + Intronic
1018308485 6:162483526-162483548 GGCGGGGAAGGAAGGAAAGAAGG + Intronic
1018725124 6:166606318-166606340 ATCGAGCAAGGAAGGCAAGAGGG - Intronic
1019155525 6:170036311-170036333 TTCTGGGAAGGAATTCAAGCTGG - Intergenic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1020569543 7:9841784-9841806 CTGTTGGAAGGAAGGGAAGCAGG + Intergenic
1021331626 7:19345577-19345599 CTAAGGGAAGGAAGGAAGGAAGG - Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022875707 7:34526788-34526810 AGATGGGAAGGAAGGAAAGAGGG - Intergenic
1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG + Intronic
1023366438 7:39468911-39468933 ATCTGAGAAGGAAGCCAAGCAGG - Intronic
1023628609 7:42140919-42140941 CTCTAGGAGGGAAGGAAGGAAGG + Intronic
1023704151 7:42922540-42922562 TTCTGGAAAGGAAGATAAGAGGG + Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025175366 7:56798178-56798200 CTTTGGGAAGGCAGGGTAGAAGG - Intergenic
1025696434 7:63778235-63778257 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025913214 7:65844545-65844567 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1026011231 7:66638232-66638254 CTCTAAGCAGGAAGGAAAGAGGG - Exonic
1026324013 7:69293273-69293295 CTCTGGAAAGGAAGGAAGGAAGG - Intergenic
1026743094 7:72990913-72990935 CTCTGGGAACCAAGGAATGAAGG - Intergenic
1026802964 7:73411366-73411388 CTCTGGGAACCAAGGAATGAAGG - Intergenic
1026924099 7:74177498-74177520 CTGGGGGAAGGAGGGCAATAGGG - Intronic
1026941629 7:74290528-74290550 CCCTGGGAAGGACGGGCAGAGGG + Intronic
1027029209 7:74875617-74875639 CTCTGGGAACCAAGGAATGAAGG - Intergenic
1027100641 7:75374165-75374187 CTCTGGGAACCAAGGAATGAAGG + Intergenic
1027287145 7:76658364-76658386 CTCTTAGAAGGGAGGCAACATGG - Intergenic
1027716232 7:81674245-81674267 CTCTGAAAAGGAAGGAAGGAAGG + Intergenic
1027828731 7:83150619-83150641 ATCTGGGAAGGAAGGAAGGAAGG - Intronic
1029485228 7:100836193-100836215 CTCTAGGAGGGAAAGTAAGAAGG + Intronic
1029493498 7:100884817-100884839 CTCCGAGAAGGAAGCCAAAAAGG + Exonic
1030006336 7:105124273-105124295 CAGCGGGAAGGAAGGAAAGAGGG - Intronic
1030524644 7:110638517-110638539 CTCTTGGAGGGAAGAAAAGATGG - Intergenic
1030535552 7:110762046-110762068 CTTTGGAAAGGAAGGGATGATGG - Intronic
1030697809 7:112604592-112604614 TTCTGGGAAGGAAAGGAGGAAGG - Intergenic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1031351671 7:120739640-120739662 ATTTAGGAAGGAAGGGAAGAGGG + Intronic
1031545193 7:123043988-123044010 TTCTGGGAAGGAAGGAAGGAAGG - Intergenic
1031680745 7:124671254-124671276 CTTAGGGTAGGAAGGCAAGAAGG + Intergenic
1031951058 7:127892597-127892619 AGCTGGAAAGGAAGGCCAGAAGG - Intronic
1032007615 7:128315955-128315977 CTGTGGGAAGGAAGGCATCAAGG + Intronic
1032029022 7:128466695-128466717 TTCTGGGAAGGAACTCAACAAGG - Intergenic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1032901246 7:136311140-136311162 CCCTGGAGAGGAAGGCAAGAGGG + Intergenic
1032955770 7:136970362-136970384 ATCTTGGAAGGAAGTCATGAAGG - Intronic
1033048882 7:137986382-137986404 GACTGGGAAGGAGGGCAAGTTGG + Intronic
1033060434 7:138101204-138101226 CTCGTGGAAGGAAGGAAGGAAGG - Intronic
1033994956 7:147334089-147334111 CTTTGGGATGGCAGTCAAGATGG - Intronic
1034523702 7:151640667-151640689 ATCGGGGAAGGAAGGAAGGAAGG - Intronic
1034532149 7:151702505-151702527 ATAGGGGAAGGAAGGCAAGCGGG - Intronic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1035326189 7:158067737-158067759 CTCTGGGAAGGAAGCCTGGTGGG - Intronic
1035450752 7:158975636-158975658 AGCTGGGAAGGAAGACAGGAGGG + Intergenic
1035453330 7:158993103-158993125 ATCAGGAAAGGAAGGCAGGAAGG - Intergenic
1035992712 8:4510595-4510617 AGGAGGGAAGGAAGGCAAGAAGG - Intronic
1036579513 8:10061027-10061049 CTCTGGGCAGGATGCAAAGAGGG - Intronic
1037492629 8:19410578-19410600 CCTTGGGAAGGAAGACAAGAGGG + Intronic
1037698775 8:21252773-21252795 CTGAGGGAAGCAAGGCAATAGGG + Intergenic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1037939969 8:22943986-22944008 CTATGGGAAGGAAAGAAGGAAGG - Intronic
1038264791 8:26030143-26030165 TTCTGAAAATGAAGGCAAGAAGG + Intronic
1038455492 8:27669804-27669826 CTCTGGGAAGAAAACAAAGAGGG + Intronic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1038707502 8:29908621-29908643 CTTCGGGAAGGAAGGAAGGAAGG + Intergenic
1039845448 8:41322393-41322415 CTTTTGGAAGGAAGGAAGGAAGG + Intergenic
1040407065 8:47115700-47115722 TTCTGGGGAGGAATGCAAGCTGG - Intergenic
1040568904 8:48591194-48591216 CTCTGTGAATGTAGGCAGGAAGG + Intergenic
1041029017 8:53717271-53717293 CACTGGGAATGAGGACAAGAAGG + Intronic
1041423763 8:57697137-57697159 CTCTTGTAAGGAAGGCCTGATGG - Intergenic
1041516135 8:58700699-58700721 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
1041741478 8:61162077-61162099 CTCTGGGAAAGACGGCAAGAAGG - Intronic
1041779405 8:61561033-61561055 GTAAGGGAAGGAAGGGAAGAAGG + Intronic
1043451090 8:80367444-80367466 CTCAGAGAAGAAAGGAAAGAGGG - Intergenic
1043968439 8:86504998-86505020 ATCTGGGAAGGATGGCATCATGG + Intronic
1044184913 8:89239761-89239783 CCCTGAGAAGAAAGGAAAGAGGG + Intergenic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1044537974 8:93379388-93379410 CTCTGGGAATGCAGGCGAAAGGG - Intergenic
1044562148 8:93623072-93623094 TTATTGGAAGGAAGGAAAGAAGG + Intergenic
1044772144 8:95647217-95647239 ATATGGGAAGGAAGGAAAGTAGG + Intergenic
1044773215 8:95659526-95659548 ATCTGGGAACGGAGGCAAGAAGG + Intergenic
1044836057 8:96296943-96296965 CACTGGGAAGCAGGGAAAGAAGG - Intronic
1045078955 8:98603749-98603771 GCCTGGGAAGGAAGGGAAGAAGG + Intronic
1045550100 8:103163840-103163862 TTGTGGGAAGGAAGGAAGGAAGG - Intronic
1045752934 8:105507982-105508004 CTTTGTCAAGGAAGGAAAGAAGG + Intronic
1045976626 8:108137145-108137167 CTCTGGGAGGGAAGGTGAAATGG - Intergenic
1046755275 8:117966605-117966627 CTCGGGAAAGAAAGGAAAGAGGG - Intronic
1047230969 8:122997467-122997489 ATTTGGGATAGAAGGCAAGAAGG - Intergenic
1047511886 8:125521782-125521804 GGCTGGGAAGGAAGGCAGGAAGG - Intergenic
1047734041 8:127750289-127750311 CTATCGGAAGGAAGGAAGGAAGG - Intergenic
1047958956 8:129997032-129997054 CTTTGTGAAGGAAGGAAGGAAGG + Intronic
1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG + Intergenic
1049347947 8:142148663-142148685 CTCTGGGGCCGAAGGCCAGATGG + Intergenic
1049414147 8:142487792-142487814 TTCTGGGAAGGAAGGCATTGGGG - Intronic
1049479619 8:142815669-142815691 TTCTGGGTGGGAAGGAAAGAGGG - Intergenic
1049526202 8:143127995-143128017 CTCTGGGCAGCAAAGCAAGCTGG - Intergenic
1049831648 8:144704799-144704821 CTCTAGGGAGGAGGGCAAGCTGG + Intergenic
1049983777 9:929213-929235 CCCTGGGATAGAAGGCAAAATGG + Intronic
1050106812 9:2174215-2174237 CTCTCTGAAGGAAGGGAAGGAGG + Intronic
1051298961 9:15628034-15628056 CACTGGGGAGGGAGCCAAGATGG + Intronic
1051302743 9:15670636-15670658 CTATGGAAAGGATGGGAAGAGGG - Intronic
1052278204 9:26702628-26702650 CTCTGGGAAGCAAGGGAGAAAGG - Intergenic
1052356378 9:27509267-27509289 CTATAGGAAGGAAGGGAGGAAGG + Intronic
1052670455 9:31550936-31550958 CTCTGGGATGGAAGGAGAAATGG + Intergenic
1053055998 9:34993431-34993453 GTATGGGGAGGAAGGTAAGAGGG + Exonic
1053343226 9:37357160-37357182 GTCTCCCAAGGAAGGCAAGAGGG + Exonic
1053803091 9:41776275-41776297 CACTGAGAAGTAAGGCATGAAGG + Intergenic
1054808266 9:69413069-69413091 TTCTGGGAAGGAAGGCTGAAGGG + Intergenic
1054935807 9:70686651-70686673 TTCCAGGAAGGAAGGCAGGAAGG - Intronic
1055343122 9:75307137-75307159 CTCTTGCAAGGCAGGCCAGATGG + Intergenic
1055869984 9:80865297-80865319 CTATGGGAAGGAAGGGAGGGAGG - Intergenic
1056112146 9:83406539-83406561 CTCAGGAAAGGAAGGAAGGATGG + Intronic
1056443147 9:86640201-86640223 GCATGGGAGGGAAGGCAAGAAGG - Intergenic
1056464095 9:86837061-86837083 CACAAGGAAGGAAGGCAACAGGG + Intergenic
1056502963 9:87228590-87228612 CTCATGGAGGGAAGGCAAGGTGG - Intergenic
1056524762 9:87432954-87432976 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
1056827676 9:89888002-89888024 ATCTGGGAAGGAAGGAAGGAAGG + Intergenic
1056869724 9:90266290-90266312 ATGAGGGAAGGAAGGAAAGAAGG - Intergenic
1057349329 9:94281978-94282000 ATCTGGGAAGGAAGGAAGGAAGG + Intronic
1058000615 9:99861503-99861525 CTCTGTCAAGGAAGGAAGGAAGG + Intronic
1058483793 9:105423030-105423052 AACTGGGACGGAAGGAAAGAGGG + Intronic
1059035318 9:110748141-110748163 ATAAGGGAAGGAAGGAAAGAAGG - Intronic
1059037812 9:110777167-110777189 CTCTGGGAAAGAATTCAAGAAGG + Intronic
1059110837 9:111557130-111557152 TTCTGGGGAGGAATTCAAGAAGG - Intronic
1059316031 9:113426562-113426584 AGATGGGAAGGAAAGCAAGAGGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059436842 9:114282291-114282313 ATCAGGGAAGCAAGGCGAGAAGG + Exonic
1059756589 9:117299535-117299557 ACAAGGGAAGGAAGGCAAGAAGG + Intronic
1059943042 9:119376448-119376470 GACTGGGAAGGAAGGAAACATGG + Intergenic
1060023875 9:120154966-120154988 CTCTAGGAAGGAAGGAAGGAAGG + Intergenic
1060145468 9:121248812-121248834 GTCTGGGAAAGAAGGCGAGTAGG + Intronic
1061069036 9:128297284-128297306 CACTGGGAAGGAAGCCGAGCAGG - Intergenic
1061264971 9:129499583-129499605 CCCTGGGATGGAAGCAAAGAGGG + Intergenic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062382203 9:136291874-136291896 CTCCTGGCAGGAAGGCAGGATGG - Intronic
1203793904 EBV:166043-166065 CTCTGAGAAACAAGGCGAGAGGG - Intergenic
1185492537 X:528790-528812 CAGAGGGAAGGAAGGAAAGAAGG - Intergenic
1185556796 X:1028056-1028078 GTCTTGAAAGGAAGGAAAGAAGG - Intergenic
1187036171 X:15542267-15542289 CACTGGTAGGGAAGGCAAGAAGG + Intronic
1187252889 X:17614959-17614981 ATCAGGGAAGTAAGGGAAGAGGG - Intronic
1187759281 X:22562229-22562251 CTCCAGAAAGGAAGGCAAAAGGG + Intergenic
1188053767 X:25517796-25517818 CACTGGGAAGGAAGGGAGGGAGG + Intergenic
1188782778 X:34306064-34306086 CTCAAGGAAGGAGGGCAAGCCGG - Intergenic
1188963875 X:36526892-36526914 AACAAGGAAGGAAGGCAAGAAGG + Intergenic
1189289875 X:39877520-39877542 CTTTGGGAAGGAGGCCAAGGTGG - Intergenic
1189343523 X:40222653-40222675 CCCTGAGAAGGAAGGAAAGAAGG + Intergenic
1189390429 X:40571664-40571686 CTCTGGGAAGGCAGCCCAGTAGG + Intergenic
1189609000 X:42711473-42711495 CGCTGGAAAGGAAGGGAAGAAGG + Intergenic
1189836025 X:45023789-45023811 CTCGGGGAAGAGAGGCAAGGGGG - Intronic
1189971012 X:46418391-46418413 TTCTGGAAGGGAAGCCAAGAGGG + Intergenic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1190278334 X:48913465-48913487 ATTTGGGAAGGAATGGAAGATGG - Exonic
1191796402 X:65026189-65026211 CTTTGGGGAGGAAGGAATGAAGG + Intronic
1191862870 X:65680094-65680116 GTTTGGGAAGGTAGGCAAGCAGG + Intronic
1191931156 X:66374818-66374840 CTCTTGTAAGGAAGGCCTGAGGG + Intergenic
1192253185 X:69430762-69430784 CTCTTGGAAGAAATGAAAGAAGG + Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192449327 X:71233659-71233681 CCCTGGGAAGGGAGGCAACCTGG + Intergenic
1192617238 X:72639288-72639310 CTTTGGGAAGGAGGCCAAGGTGG + Intronic
1192831129 X:74751846-74751868 CTCTGGAAAGGAAGGAAGGAAGG - Intronic
1193137152 X:77984674-77984696 CTTTGGGCAGGAAGTCAAAATGG - Intronic
1193527515 X:82611903-82611925 CTCTGGGGAGGAATGGAAGGTGG + Intergenic
1194855085 X:98918431-98918453 TTCTGGGAAGGAATTCAAGTAGG + Intergenic
1195829461 X:109040084-109040106 CTCTGAGAAGGAAGGCCACAGGG - Intergenic
1197703849 X:129619549-129619571 CTTTGGCCAGGAAGGAAAGAAGG - Intergenic
1197792740 X:130271766-130271788 ATCTGGAAAGGAAGGAAGGAAGG - Intergenic
1197961459 X:132010852-132010874 CTTTTGGAAGGAAGGCAGTAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198597299 X:138250364-138250386 CTCTTGGAAGGAAGCAAGGAAGG + Intergenic
1198991147 X:142515929-142515951 GGCTGGGGAGGAAGGCAAGGAGG + Intergenic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1199220597 X:145311519-145311541 TTCTGGGAAGGAATTCAAGCAGG - Intergenic
1199655780 X:149994161-149994183 CTTTGGCAAGGATGGCAGGAAGG + Intergenic
1200140622 X:153901062-153901084 CTCTGGGGAGGAAAGCGGGAGGG + Intronic
1200691464 Y:6308708-6308730 ATCTGGGAAGGAAGGGCAGTGGG - Intergenic
1201043808 Y:9866008-9866030 ATCTGGGAAGGAAGGGCAGTGGG + Intergenic
1202115043 Y:21464507-21464529 ATCTGGCAAGGAAGGGAAGTGGG + Intergenic