ID: 1064725286

View in Genome Browser
Species Human (GRCh38)
Location 10:18272923-18272945
Sequence CAGAGATCTGCATTTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064725286_1064725292 13 Left 1064725286 10:18272923-18272945 CCCCAAAAAAATGCAGATCTCTG 0: 1
1: 0
2: 3
3: 39
4: 377
Right 1064725292 10:18272959-18272981 ACTCATAGACTCTGAATCTCAGG No data
1064725286_1064725293 14 Left 1064725286 10:18272923-18272945 CCCCAAAAAAATGCAGATCTCTG 0: 1
1: 0
2: 3
3: 39
4: 377
Right 1064725293 10:18272960-18272982 CTCATAGACTCTGAATCTCAGGG No data
1064725286_1064725294 18 Left 1064725286 10:18272923-18272945 CCCCAAAAAAATGCAGATCTCTG 0: 1
1: 0
2: 3
3: 39
4: 377
Right 1064725294 10:18272964-18272986 TAGACTCTGAATCTCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064725286 Original CRISPR CAGAGATCTGCATTTTTTTG GGG (reversed) Intronic
901498401 1:9636188-9636210 AACAATTCTGCATTTTTTTGGGG + Intergenic
901905420 1:12405261-12405283 CGGAAATCTGGATTTTTATGTGG + Intronic
903015147 1:20356705-20356727 CAGAGATCAGCAGTTTTCTTGGG - Intergenic
903994353 1:27296501-27296523 CAGAGATCTGCTATTTTTGGAGG - Intronic
904590106 1:31608917-31608939 CAGATGTCTGCATTTGTTAGGGG - Intergenic
905177504 1:36146862-36146884 CAGAGCTCTGCATATAGTTGGGG + Intronic
906733668 1:48104432-48104454 GTGAGATCTCCAATTTTTTGTGG - Intergenic
907122768 1:52022072-52022094 CAGTGATCTGCATTTGGTTAAGG + Intronic
907759085 1:57340224-57340246 CAGTGATCTGCATTTTTGTTTGG - Intronic
908183866 1:61633043-61633065 CAGAGCTTTGAATTTTTGTGAGG - Intergenic
908268605 1:62401875-62401897 CAGAGGTGTGCATTTTTGGGGGG + Intergenic
908674230 1:66584346-66584368 CAGAGATTTGCTTCTCTTTGAGG - Intronic
909408471 1:75320199-75320221 CAAAGATCTGGTTTTCTTTGAGG - Intronic
909606663 1:77515106-77515128 AAGTGGTCTGCATTATTTTGGGG + Intronic
910020325 1:82581023-82581045 CAGAGATTTGTAGTTTTTTTCGG - Intergenic
910171417 1:84381481-84381503 CAGAGATTTGCGTTCTTTTCAGG + Intronic
910378236 1:86596436-86596458 CAGAGAGCTGCTTTTATCTGAGG + Intergenic
910944248 1:92571800-92571822 CAGAAACCTGCATTTTCTTGAGG + Intronic
912277974 1:108280848-108280870 CATAGATCTCCTTTTCTTTGGGG + Intergenic
912290252 1:108413509-108413531 CATAGATCTCCTTTTCTTTGGGG - Intronic
912640788 1:111344032-111344054 CTGATATCTGGATTTTTCTGTGG + Intergenic
912772500 1:112477533-112477555 CATAGATCTCTATTTCTTTGGGG - Intronic
912849963 1:113115081-113115103 CACAGCTCTTCAGTTTTTTGAGG - Intronic
913427824 1:118754198-118754220 CAGATCTCTGGATTTCTTTGAGG + Intergenic
913966356 1:143380617-143380639 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914060729 1:144206224-144206246 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914118421 1:144760145-144760167 CTGTAAGCTGCATTTTTTTGAGG - Intergenic
915882109 1:159683153-159683175 CAGAGATAAGCATTATTCTGGGG - Intergenic
916184423 1:162116905-162116927 CATAGATCTGTAGCTTTTTGGGG + Intronic
917578938 1:176354562-176354584 CACAGATCTCCATTTCTTTCGGG + Intergenic
918279667 1:182991670-182991692 CATACATATGCATTTTTTTCTGG - Intergenic
918653624 1:186997272-186997294 CTGAGGTTTGCATTCTTTTGAGG + Intergenic
918888559 1:190232181-190232203 CAGAGATCTTCATGTCTTTTGGG - Intronic
920871446 1:209798428-209798450 CAGAGCTCTGCACATTTCTGTGG + Intronic
922322229 1:224498886-224498908 GAGAGATTCGCATTTTTTTGTGG + Intronic
922386358 1:225087760-225087782 CAGAGATCTTCATAGATTTGTGG + Intronic
923489637 1:234473105-234473127 CAGTGTTCTCCATTCTTTTGGGG - Intronic
923496174 1:234526834-234526856 AAGTGATCTGCATTTTTAGGTGG - Intergenic
924152263 1:241141359-241141381 CAGGGATCTGCATTTGAGTGTGG - Intronic
1063044113 10:2373965-2373987 CAGAGAGCTGCAACTTTGTGGGG - Intergenic
1063811357 10:9712810-9712832 CATAGATCTCCATTCTTTTGGGG + Intergenic
1064424084 10:15214552-15214574 CAGGGAGCTGCAGTTTTCTGTGG + Exonic
1064725286 10:18272923-18272945 CAGAGATCTGCATTTTTTTGGGG - Intronic
1064887961 10:20134203-20134225 CATAGATCTCCAATTCTTTGAGG + Intronic
1067716595 10:48695200-48695222 CAGGGATCTGCTTTTCTCTGGGG + Intronic
1068540210 10:58284168-58284190 CTAATTTCTGCATTTTTTTGTGG - Intronic
1068562550 10:58531582-58531604 CACAGATCTCCATTTCTTTTGGG - Intronic
1070316136 10:75314087-75314109 CGCAGATCTCCATTTCTTTGAGG - Intergenic
1071233307 10:83614817-83614839 CACAGATCTTCATTTATTTAGGG + Intergenic
1071909992 10:90220616-90220638 CAGAAAGCTGCTTTATTTTGGGG + Intergenic
1072296638 10:94014802-94014824 AAGAGATCTGCATTTTTAGCAGG - Intronic
1072988887 10:100170382-100170404 TAGAGATCTCCATTGTTTTAGGG - Intronic
1073163099 10:101418385-101418407 CAGACATTTATATTTTTTTGGGG + Intronic
1074018176 10:109556902-109556924 TAGAGATCTGTCTTTTTATGGGG + Intergenic
1074040961 10:109787765-109787787 CAGAGTTATGGATTTTTTTAGGG + Intergenic
1074255286 10:111796266-111796288 CAGAATTCTGCATTTCTTTCTGG + Intergenic
1075415869 10:122263716-122263738 CATAGATCTCTATTTTTTAGGGG + Intergenic
1075531970 10:123237226-123237248 CAGAGATTCTCCTTTTTTTGAGG + Intergenic
1075760421 10:124851204-124851226 CAGATGTCTGCATATATTTGGGG + Intergenic
1075995440 10:126873058-126873080 AAGAGCTCTGCATTTTTCTTGGG - Intergenic
1078722729 11:13898922-13898944 CAGAGACATGCATTTTTTATGGG + Intergenic
1080091855 11:28357777-28357799 CAGAAATCTTCATTTCTTTCGGG + Intergenic
1080239062 11:30105534-30105556 AAGTGATCTGCATGTATTTGAGG + Intergenic
1081292185 11:41340220-41340242 CAGAGATTTTGATTTTTGTGTGG + Intronic
1083076430 11:60043527-60043549 CAGAAATCTGTATATATTTGCGG + Exonic
1084636143 11:70394198-70394220 CATATATTTGCATTGTTTTGAGG + Intergenic
1084929261 11:72541358-72541380 CAGAGAGCTGCACTTCTTTGTGG - Intergenic
1085741655 11:79082559-79082581 CACATATGTGCATTTTTCTGGGG - Intronic
1086761846 11:90641303-90641325 GAGAGCTCTGTATTTTTCTGTGG + Intergenic
1087124779 11:94614217-94614239 CACAAATCTCCATTTCTTTGAGG + Intronic
1087227657 11:95620307-95620329 CATAGATCTTCATTTCTTTAGGG - Intergenic
1087786464 11:102360618-102360640 CATAGATCTCCATTTCTTTGTGG + Intronic
1088630551 11:111770189-111770211 CAGAAATCTGCATTTTTAACAGG - Intergenic
1090599173 11:128352565-128352587 GAGATAGCTGCATTTTTTTTCGG - Intergenic
1090625861 11:128608065-128608087 CAGAGATCAGCAAATATTTGTGG - Intergenic
1090763184 11:129854918-129854940 CAGAGATGTGGATTTTCTGGGGG - Intronic
1093248164 12:16766210-16766232 CAAATATTTGCATTTTTTTCTGG + Intergenic
1093260230 12:16927660-16927682 CATAGATCTTCATTTCTTTAGGG + Intergenic
1093842339 12:23919279-23919301 CAAAAATCTGGATTTTTATGAGG + Intronic
1093978870 12:25453061-25453083 CAGGGCTCTGCATTTCTCTGTGG + Intronic
1094957158 12:36026121-36026143 CAGATATCTGCACCTCTTTGAGG + Intergenic
1095266950 12:40171899-40171921 CAGAGAACTTTATTTCTTTGAGG - Intergenic
1095417335 12:41990946-41990968 CTGAGATCTGCATTTTTAATAGG - Intergenic
1095472394 12:42550995-42551017 CTGAGCTCTGCAATTATTTGAGG + Intronic
1095501621 12:42846220-42846242 CATAGATCTCCATTTATTTGGGG + Intergenic
1095624189 12:44295822-44295844 CATAGATCTCAATTTCTTTGGGG + Intronic
1095782588 12:46076586-46076608 TAGAGATCTGCATTTTATAGAGG + Intergenic
1096352718 12:50913578-50913600 CATAGATCTCCATTTCTTTAGGG - Intergenic
1098509000 12:71289998-71290020 CAGAAATCTGCATTTCTTTGGGG + Intronic
1098821128 12:75231621-75231643 CATAGATCTCCATTTCTTTGGGG + Intergenic
1099599078 12:84708731-84708753 CAGGAATGAGCATTTTTTTGAGG + Intergenic
1100131838 12:91503891-91503913 CAGAGATGTGCATTCATATGGGG - Intergenic
1100700848 12:97146140-97146162 CTGAGAACTGCATTTATTTGAGG - Intergenic
1101000655 12:100354367-100354389 CCTAGATCTGCAGTTTCTTGTGG - Intergenic
1103553634 12:121752747-121752769 CAGTGAACTCCTTTTTTTTGGGG - Intronic
1103557995 12:121777461-121777483 CAGAAATCTGGATTTTTATGTGG - Exonic
1105338270 13:19495264-19495286 CAGAGCTCTGCCTTTATGTGAGG - Intronic
1106072656 13:26427151-26427173 CAAAGATCTGCATTCTCTGGTGG + Intergenic
1106156741 13:27165655-27165677 AAGGGATTTGAATTTTTTTGAGG - Intronic
1107290477 13:38847214-38847236 CACATATCTGCATTTTATTCCGG + Intronic
1107327050 13:39255664-39255686 CAGAGTTCTGCATTCCTATGAGG - Intergenic
1107369307 13:39725863-39725885 CATAGATCTTCATTTTTGGGGGG - Intronic
1109273325 13:60278069-60278091 CAGGGATCTGGAATCTTTTGGGG - Intergenic
1109636208 13:65121141-65121163 GAGAGATCTACATTTATTTACGG + Intergenic
1109896751 13:68701628-68701650 CATAGATCTCCATTTTTTGGAGG - Intergenic
1109916378 13:68990579-68990601 AACAGATATGCATTTATTTGTGG - Intergenic
1110671751 13:78188836-78188858 CAGAGAACTGCAAGATTTTGAGG - Intergenic
1111602443 13:90492600-90492622 CACAAATCTTCATTTCTTTGGGG + Intergenic
1111752207 13:92346703-92346725 CAGAGATCTCCATTTCTTTAGGG - Intronic
1111802030 13:92993139-92993161 CAAAGGACTGCATTTTTTTCTGG + Intergenic
1112067063 13:95803831-95803853 CAAAGATCTCCAGGTTTTTGAGG + Intronic
1112118120 13:96379663-96379685 AAGAAATCTGCATTTTTATCGGG - Intronic
1112252357 13:97793746-97793768 AAGAGAACTGCATTTCTTGGGGG - Intergenic
1112511742 13:100015879-100015901 CAGAGCTCTGATTTTGTTTGGGG + Intergenic
1112649296 13:101375417-101375439 CAGAGATATTCACTTATTTGTGG + Intronic
1112964502 13:105171016-105171038 CAGAGATCTCCATTTCTTTGAGG + Intergenic
1113181662 13:107635379-107635401 AAGAGATCTGATTTTTTTTAAGG - Intronic
1114700437 14:24672796-24672818 CAGAAATCTGTATTTTTTACAGG + Intergenic
1115170708 14:30502844-30502866 CAGAGACCAGAATTTTTTTGAGG - Intergenic
1115641279 14:35337108-35337130 AACAGATTTGCATTATTTTGTGG - Intergenic
1116372660 14:44155245-44155267 CATAGATCTCCATTTTTGTAGGG - Intergenic
1118499874 14:66350022-66350044 CACACATCTGCATTTCTTTAGGG - Intergenic
1118815145 14:69306988-69307010 CAGAGATGTGTGTTTTATTGAGG - Intronic
1119020486 14:71107326-71107348 CTGAGATCTGTTTTCTTTTGTGG + Intronic
1120329442 14:83071836-83071858 CATAGATCTCCATTTCTTTGTGG + Intergenic
1121269989 14:92631582-92631604 CAGGAATCTGCATTTTTTTTTGG + Intronic
1125432570 15:39610118-39610140 CATAGCTCTACATTTTTTTCAGG - Intronic
1126327368 15:47494927-47494949 AAGAGAAATGCAGTTTTTTGTGG + Intronic
1127920470 15:63490491-63490513 CAGAGTTCCCCTTTTTTTTGAGG - Intergenic
1128902011 15:71432010-71432032 AAGAGATCTGGTTATTTTTGTGG + Intronic
1129584054 15:76844393-76844415 CATACACGTGCATTTTTTTGGGG - Intronic
1129911343 15:79229672-79229694 TATAGATCTCCATTTCTTTGGGG + Intergenic
1130410308 15:83642293-83642315 CATAGATCTACATTTCTCTGGGG + Intergenic
1130912482 15:88280660-88280682 AAGAGATATGGAGTTTTTTGGGG - Intergenic
1131799049 15:96050982-96051004 TAAAGATGTTCATTTTTTTGTGG + Intergenic
1134285067 16:12854165-12854187 CAGACGTCAGCATTTTTTTCGGG + Intergenic
1134797606 16:17056378-17056400 TGGAGATCTTCATTTTTTTAGGG + Intergenic
1135208717 16:20504814-20504836 CATAGATATCCAATTTTTTGTGG - Intergenic
1135231073 16:20707880-20707902 CATAGATATCCAATTTTTTGTGG - Intronic
1135249132 16:20885608-20885630 CAGAGATTTCCATTTTATTCTGG + Intronic
1135757183 16:25107827-25107849 CAGGGATGTGCATTTCTTAGGGG + Intergenic
1137037889 16:35581723-35581745 CACGGCTCTGTATTTTTTTGTGG + Intergenic
1137519534 16:49180188-49180210 CAGAGTGCTGCTGTTTTTTGAGG - Intergenic
1138255100 16:55549827-55549849 CCTAGATCTGCCTTTTTTTCTGG + Intronic
1139307254 16:65997598-65997620 CAGAGATGGGCATTCTTTTGTGG - Intergenic
1140652476 16:77103498-77103520 ATGAGACCTGCCTTTTTTTGTGG - Intergenic
1143936407 17:10490088-10490110 TATAGATCTCCATTTCTTTGGGG + Intergenic
1144090840 17:11854827-11854849 CAGCTATCTGCATTGTTTTGTGG + Intronic
1146829917 17:36059540-36059562 CAGATATATCCATTTTTGTGAGG - Intergenic
1147569831 17:41562758-41562780 CAGAGATATGTGATTTTTTGAGG - Intergenic
1148054688 17:44787123-44787145 CAGAAAACTCCATTTTATTGTGG + Intergenic
1149214964 17:54344130-54344152 CAGAGCTTTGCATTTTGTTAAGG - Intergenic
1149345538 17:55731325-55731347 CAGAAATGTTCATTTTATTGTGG - Intronic
1152053820 17:78005396-78005418 AGGATATCTGCATTTTTTTAAGG + Intronic
1152135354 17:78500203-78500225 CAGAGATCTGGAGTTTACTGTGG + Intronic
1158741814 18:60151376-60151398 CAGAGAGCTGGATTGTGTTGGGG + Intergenic
1158928822 18:62300541-62300563 AAGAGCTCTGCCTTTTGTTGTGG + Intronic
1159162469 18:64660846-64660868 TAGATATCTGCATTTTCCTGAGG + Intergenic
1159611251 18:70527792-70527814 CAGAGTTCTGTATTTATATGTGG + Intergenic
1160504906 18:79421523-79421545 CAGGGATCAGCCTCTTTTTGTGG + Intronic
1162247919 19:9418051-9418073 CAGAGATCACCAATCTTTTGGGG - Intronic
1162260940 19:9533494-9533516 CAGAGATCTTCATTCTTCTGGGG + Intronic
1163002082 19:14374905-14374927 CAGGGGTGTGCAATTTTTTGAGG - Intergenic
1164787664 19:30946570-30946592 CAGAGCTCTGCATTTCTTCCTGG + Intergenic
1164946934 19:32303608-32303630 TATAGATCTTCATTTCTTTGGGG + Intergenic
1164972642 19:32545699-32545721 CAGGAATCGGCATTTTTTTAAGG - Intergenic
1165677087 19:37735749-37735771 CAGAAACCTGGATATTTTTGAGG + Intergenic
1166578663 19:43870851-43870873 CAGAGATCTGAATTTTTCTCTGG - Intergenic
1168049584 19:53818774-53818796 CAGGAATCTGCATTTTGATGTGG - Intronic
1168352431 19:55684336-55684358 CAAAGTTGTGCCTTTTTTTGAGG + Intronic
1168628789 19:57940347-57940369 AAGAGATCAACTTTTTTTTGTGG - Intergenic
1202700137 1_KI270712v1_random:158112-158134 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
925965941 2:9066292-9066314 CATAGATCTCCATTTCTTTGGGG + Intergenic
927927825 2:27025608-27025630 CAGAGGTCTGCATGTTTTTTGGG - Exonic
928655940 2:33452217-33452239 CATAGATCTCCATTTATTTAGGG + Intronic
929648736 2:43656289-43656311 CACAGATTTGCTTTGTTTTGAGG - Intronic
929686923 2:44043325-44043347 CAGAGATCATCATTAGTTTGGGG + Intergenic
930509960 2:52332172-52332194 TAGAGATTTGCATTTTTTATAGG - Intergenic
931528754 2:63188779-63188801 TACAGATCTGCATTTCTTTAAGG + Intronic
931553484 2:63473038-63473060 CAGAGATCACCATACTTTTGTGG - Intronic
933716013 2:85361430-85361452 CAGAGTTCATCCTTTTTTTGTGG + Intronic
934171070 2:89541587-89541609 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
934281375 2:91615905-91615927 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
935284697 2:101553936-101553958 CAGAGAGCTACATGTATTTGGGG - Intergenic
936000183 2:108819846-108819868 CAGAGATCTGCATTTCTTTAGGG - Intronic
936644229 2:114350217-114350239 AAGGGGTCTACATTTTTTTGAGG + Intergenic
936689151 2:114865315-114865337 CAGAGATCTGCATTATTTACTGG + Intronic
939142540 2:138372120-138372142 CAGATATGTACATTCTTTTGAGG - Intergenic
939420455 2:141961768-141961790 CAGAGATCTAAATTTTTTAAAGG - Intronic
939564215 2:143767393-143767415 CAGGATTCTGCATTTTATTGTGG + Intronic
939647392 2:144717351-144717373 CAGAGATCTGCTACTTTTAGGGG + Intergenic
939939500 2:148332724-148332746 CAGAGATCTGAAATTTTATTAGG + Intronic
940646768 2:156400181-156400203 CTGAGATGTGCATTTATTTTCGG + Intergenic
941193823 2:162421351-162421373 CAGAGAAGTGAATTTTTATGGGG + Intronic
941219437 2:162757545-162757567 AAGATATATACATTTTTTTGTGG - Intronic
942292266 2:174485205-174485227 CAGAGCTCTTCATTTTTCTCAGG + Intronic
942367493 2:175243028-175243050 TAGAAATCTCCATTTTTTAGTGG - Intergenic
943848035 2:192676688-192676710 CAGAGAGCTACATTTATTTAAGG + Intergenic
944276750 2:197847587-197847609 CAGATATTTGGATTTTTATGTGG + Intronic
944373154 2:199010664-199010686 CACATATCTCCATTTATTTGGGG + Intergenic
945129504 2:206554174-206554196 AAGATATCTGCATTTTTTTCAGG - Intronic
945655798 2:212621473-212621495 CACAGATTTCCATTTCTTTGGGG - Intergenic
945805667 2:214487130-214487152 CAGCAATCTGGATTCTTTTGAGG - Intronic
1168730542 20:75208-75230 CATATATCTCCATTTCTTTGTGG - Intergenic
1170056257 20:12207811-12207833 CATAGATCTGCATTTCTTTAGGG + Intergenic
1170726685 20:18934753-18934775 CATATATTTGCATTGTTTTGAGG + Intergenic
1171148521 20:22806467-22806489 AGGAGAACTGGATTTTTTTGAGG + Intergenic
1172053467 20:32137467-32137489 CAGAAATCTCCATTTCTATGAGG - Intronic
1173020142 20:39260203-39260225 CAGAGATCTACCTTTCTTTTGGG + Intergenic
1173157650 20:40628185-40628207 GAGAGATCGGCATTTTGGTGGGG - Intergenic
1173568586 20:44060605-44060627 CATATATTTGCATTGTTTTGAGG - Intronic
1175851800 20:62097727-62097749 CAGGCATCTGCATGCTTTTGGGG + Intergenic
1176834888 21:13784399-13784421 AAGAGATGTGGCTTTTTTTGGGG - Intergenic
1177275190 21:18902419-18902441 CAGAGTTGTGTATTTTATTGAGG + Intergenic
1177875970 21:26632600-26632622 CATAGATCTTCATTTCTTTAGGG + Intergenic
1179127289 21:38601327-38601349 AAGAGATCTGCCTTTTCTTTAGG - Intronic
1179181240 21:39046953-39046975 CAGAGAACAGCATTTTTTCCTGG + Intergenic
1181748354 22:24971708-24971730 CAGAAATTGGTATTTTTTTGGGG + Intronic
1183147070 22:36003042-36003064 CAGAGATCTTCATTGTATAGGGG - Intronic
1183981129 22:41540954-41540976 CAGAGCTCTGCATCCTTCTGAGG - Intronic
949581333 3:5391507-5391529 CAGAAATCTGCATTCTAGTGGGG - Intergenic
951131879 3:19056222-19056244 CAGAGATCTCCATTTCCTAGAGG - Intergenic
951230632 3:20174546-20174568 CAGATTTGTGCATTTTTTTTTGG + Exonic
951693667 3:25423526-25423548 CATAGATCTGTATATTTTTTTGG - Intronic
952150252 3:30581381-30581403 CATACAGCTGCGTTTTTTTGTGG - Intergenic
952712336 3:36444001-36444023 CAGACATCGGCTTTTTTTTGGGG - Intronic
952782482 3:37115640-37115662 GAGAAATCGGCATTTTCTTGAGG - Intronic
953501354 3:43437937-43437959 CACAGATCTTCATTTCTTTTGGG - Intronic
953952827 3:47205512-47205534 CAAATTTCTGTATTTTTTTGTGG + Intergenic
954032758 3:47831551-47831573 CAGAGCACTGAATATTTTTGAGG - Intronic
955052769 3:55428774-55428796 AAGAGTTCTGCTTTCTTTTGTGG + Intergenic
955134491 3:56202885-56202907 CAGTTACCTGCCTTTTTTTGTGG - Intronic
955261761 3:57397953-57397975 CATAGATCTGCATTTCCTTATGG - Intronic
956621484 3:71225590-71225612 CAGAGATTTGCATATTTTGAAGG + Intronic
956883389 3:73534037-73534059 CATGGATCTGCATTTTAATGGGG - Intronic
957575204 3:81998440-81998462 TACAGATCTGCATTTATTAGAGG + Intergenic
957736072 3:84204441-84204463 CAGAAATATGCATAGTTTTGGGG + Intergenic
959600370 3:108176227-108176249 AAGACATCTGCATTTTTCTCAGG + Intronic
959769147 3:110072036-110072058 CAGAGAAATGAAGTTTTTTGGGG + Intergenic
960598294 3:119428598-119428620 CATAAATCTCCATTTCTTTGGGG + Intergenic
960728814 3:120701469-120701491 AAGAAATCTGCATTTTTGTCAGG - Intronic
960777420 3:121274061-121274083 AATAGATCTCCATTTTGTTGAGG + Intronic
960798759 3:121515828-121515850 CACAGATCTTCATTTCTTTAGGG - Intronic
961500609 3:127330338-127330360 TATAGATCTCCATTTCTTTGGGG - Intergenic
961983243 3:131103975-131103997 CATAGCTATGCATTTCTTTGGGG - Intronic
963808529 3:149751683-149751705 CACAGTTCTGCATTTTGTTAAGG - Intronic
964301053 3:155285193-155285215 CAGAAATCTTTTTTTTTTTGAGG - Intergenic
964561284 3:157999265-157999287 GAGAGATGTCCATTCTTTTGAGG - Intergenic
965639205 3:170815007-170815029 GAGAGAGATGCATTCTTTTGAGG - Intronic
965689420 3:171339520-171339542 CAGAGATCTGCGTCTGTTTGTGG + Intronic
966065386 3:175815426-175815448 CATAGATCTCCATTTCTTTAGGG - Intergenic
966330266 3:178804091-178804113 CAGAGATCTGCGTTGTATAGTGG - Intronic
966428814 3:179809819-179809841 CTGAGGTCTCCATTTTTATGTGG - Intronic
966459994 3:180165936-180165958 TAGAGATCTGCCTATGTTTGGGG + Intergenic
966567052 3:181395539-181395561 AATAGATCTCCATTTCTTTGGGG + Intergenic
967803909 3:193696373-193696395 GGGAGATCTTCATTTCTTTGAGG + Exonic
969066766 4:4489274-4489296 AAGGGATCTGTATATTTTTGAGG - Intronic
969199547 4:5591783-5591805 CACAGATTTGCATTTCTATGAGG + Intronic
969200737 4:5603224-5603246 CAGGAATCTGAATTTTATTGGGG + Intronic
969854953 4:9991568-9991590 GAGAGATTTGGATTTTTTTAAGG + Intronic
970146227 4:13038863-13038885 CAGGGACCTGCTTTTTTTTGTGG - Intergenic
970954678 4:21796095-21796117 CAGAGATCTCCATGTTTATTAGG - Intronic
971666527 4:29493718-29493740 CACAGATATGCATTGGTTTGGGG + Intergenic
973724128 4:53755165-53755187 CATAGATCTGCCTTTCTTTAGGG - Intronic
974996752 4:69170335-69170357 CATAGATCTTCATTTCCTTGAGG + Intronic
975009734 4:69335284-69335306 CATAGATCTTCATTTCCTTGAGG + Intronic
975217922 4:71778583-71778605 TAGAAATCTAGATTTTTTTGTGG + Intronic
975672178 4:76791566-76791588 CAGAGATTTGTTCTTTTTTGTGG - Intergenic
975833563 4:78397028-78397050 CACAAATCTTCATTTCTTTGGGG + Intronic
976374213 4:84325646-84325668 CTGACATCTGCATTACTTTGAGG + Intergenic
976662398 4:87553351-87553373 CTGAGCTCTGTATTTGTTTGGGG + Intergenic
978125522 4:105130857-105130879 CAAAGCTGGGCATTTTTTTGGGG - Intergenic
978735665 4:112081364-112081386 AACAGACCTGCATTTTTTTAAGG + Intergenic
978877833 4:113663648-113663670 CAGAGATTTGAATTTTGTTATGG + Intronic
979842729 4:125465479-125465501 CAGAGATGTTCATATTTTTAGGG + Intronic
980428579 4:132659012-132659034 CAAAGGTCTGCATTTTGTTCTGG - Intergenic
980637084 4:135520377-135520399 TAAAGAACTGTATTTTTTTGTGG + Intergenic
981106147 4:140884276-140884298 CATATATCTCCATTTTTTAGGGG + Intronic
981136405 4:141215234-141215256 TAGAGATCTGGACTTTGTTGAGG + Intergenic
982031095 4:151301526-151301548 CAGAGATCTGCTTGTTTTAAAGG + Intronic
982521319 4:156419907-156419929 CAGAAACCTGCATCTTTTTAGGG - Intergenic
983253643 4:165374652-165374674 CATAGATCTCCATTTTTTTAGGG + Intronic
984465077 4:180088979-180089001 CAGGGATTTGGACTTTTTTGGGG + Intergenic
985342140 4:188965890-188965912 CAAAGATCTGCAATATTTTAAGG + Intergenic
985813547 5:2109611-2109633 CAGATGTCTGCATTTGTGTGGGG - Intergenic
986650330 5:9957251-9957273 CAGAGACATCCACTTTTTTGTGG + Intergenic
987481329 5:18462269-18462291 CAGGGATCAGCATTTTTTCTGGG - Intergenic
987821301 5:22970200-22970222 AAGAGCTCTGCATCTCTTTGGGG - Intergenic
988523911 5:31969824-31969846 CATGGACCAGCATTTTTTTGTGG + Intronic
988803204 5:34716101-34716123 CATACATCTGCAGTTATTTGTGG + Intronic
989374285 5:40743770-40743792 CAAAGATATATATTTTTTTGAGG - Intronic
990050327 5:51492151-51492173 CAGCGATCTGCATCTCTTTTTGG + Intergenic
990233001 5:53735297-53735319 CATAGATTTTCATTTATTTGTGG - Intergenic
990353451 5:54941423-54941445 CTGAAATCTGCTTTTTTTTGAGG - Intergenic
990629950 5:57657852-57657874 CTGTGATATGCATTTTATTGTGG + Intergenic
992493362 5:77267492-77267514 GAGAGGTCTGCCTTATTTTGGGG + Intronic
992625679 5:78634116-78634138 CAGAAATATGCTTTTTTTGGGGG - Intronic
993826048 5:92688185-92688207 CAGAGAACTGCCTGTTTTTTTGG - Intergenic
994769930 5:103968158-103968180 CATAGATTTCCATTTCTTTGGGG + Intergenic
995246762 5:109944179-109944201 CAGAGGACTTCATTTTTTTCAGG - Intergenic
995827626 5:116318421-116318443 CACAGATTTGGGTTTTTTTGTGG - Intronic
996040981 5:118810498-118810520 CATAGATCTCCATTTCTTTAGGG - Intergenic
997066929 5:130571754-130571776 CAGAGATATGCTTTTTACTGGGG - Intergenic
997127440 5:131242074-131242096 CAGATATCTGAATTTTATTTTGG + Intergenic
999592644 5:153165793-153165815 AAGAGATCTGCTTTTTTCTGTGG - Intergenic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1000974455 5:167749867-167749889 AAGAGATCTGCCTTTTTCTGAGG + Intronic
1001048648 5:168396034-168396056 CTGAGATCTGGGTTTTTCTGAGG - Intronic
1001887294 5:175304598-175304620 CAGAGACCTGCATTTCTGTAGGG - Intergenic
1002811764 6:637971-637993 CAGAGTTTTGAATTTTTTAGGGG + Intronic
1003210272 6:4057406-4057428 CAGAGAGCAGCAATATTTTGGGG + Intronic
1003980863 6:11388524-11388546 AAAAGATCTGCAGTGTTTTGGGG - Intergenic
1004216465 6:13709334-13709356 CTGAGTTCTGCAGTTGTTTGTGG - Intronic
1004298876 6:14439127-14439149 CAGTGATGTGAATGTTTTTGTGG - Intergenic
1004567984 6:16817009-16817031 CAGAGATCTGTGTTTGTTGGGGG - Intergenic
1007439634 6:41847189-41847211 CACAGATCTGCATTTCTTTAGGG - Intronic
1007967209 6:46014454-46014476 CAGCGATCTGCATATTTCTAGGG + Intronic
1009318412 6:62253923-62253945 CAGAGTTCTTCTTTTATTTGAGG + Intronic
1011088875 6:83572410-83572432 CAAAGTTTTGCATTTTTTTTTGG + Intronic
1011993567 6:93555569-93555591 AAGAGAACTGCCTTTGTTTGGGG + Intergenic
1012295358 6:97514782-97514804 CATATATCTCCATTTCTTTGTGG - Intergenic
1012516631 6:100069549-100069571 CATAGATCTCCCTTTCTTTGGGG + Intergenic
1013097679 6:106960889-106960911 CAGAGGATTGCATTTTTTGGAGG - Intergenic
1013171982 6:107644880-107644902 AAGAGATCTGCATGTATTTTTGG - Intronic
1013702758 6:112794314-112794336 TATAGATCTTCATTTTTTTCTGG + Intergenic
1013973390 6:116047326-116047348 CAGACATCTGTAGTTTTTTTAGG + Intronic
1014339491 6:120186890-120186912 TATAGATCTCCATTTATTTGGGG + Intergenic
1014932402 6:127349609-127349631 CATAGATCTTCATTTCTTTAGGG - Intergenic
1015381810 6:132578374-132578396 CCGAGATCTTGATTTTTCTGAGG - Intergenic
1015424685 6:133052161-133052183 CAGTGTTTTGAATTTTTTTGTGG + Intergenic
1015637482 6:135292057-135292079 CAGAAATCTGTATTTCTTTTAGG + Intronic
1016015739 6:139184030-139184052 CAGAGAGCTGCACATTGTTGTGG + Intergenic
1016479131 6:144462815-144462837 CAAAGATCTACATTTGCTTGAGG + Exonic
1016684535 6:146866429-146866451 CAGATATCGGCATATTTTAGAGG - Intergenic
1016963092 6:149692265-149692287 CAAACATTTTCATTTTTTTGTGG + Intronic
1017222403 6:151981396-151981418 CAGATATCTGGAAATTTTTGTGG + Intronic
1017985944 6:159443220-159443242 CAGAAATATACATTTTTATGTGG + Intergenic
1018307044 6:162468780-162468802 CAGAGATCTGAAATGTTTTACGG - Intronic
1018682200 6:166273827-166273849 CAGAGATCTTCCTCTTCTTGTGG + Intergenic
1019311290 7:362125-362147 CAGACTTCTGCAATTGTTTGTGG - Intergenic
1019872869 7:3781569-3781591 TACAGATCTCCATTTCTTTGGGG - Intronic
1020053821 7:5102990-5103012 CATAGATCTCCTTTTCTTTGGGG + Intergenic
1020370440 7:7426306-7426328 CAGAGTTCTGCCTATGTTTGTGG - Intronic
1020552042 7:9619806-9619828 AAGAGATATGTATTTCTTTGGGG - Intergenic
1021034207 7:15776949-15776971 CAGAGTTCTGCATTTTACTATGG + Intergenic
1021445519 7:20729748-20729770 CATGGATGTGCATTTTTTGGTGG - Intronic
1021630852 7:22646243-22646265 CATAGACCTCCATTTATTTGGGG + Intergenic
1021795696 7:24251524-24251546 CATAGATCTCCATTTCTTTAGGG - Intergenic
1023236155 7:38090550-38090572 CATAGATTTCCATTTCTTTGGGG - Intergenic
1023578645 7:41657669-41657691 CATATATCTACATTTTATTGTGG + Intergenic
1023657870 7:42444140-42444162 CAGAGATTTGTGTATTTTTGTGG + Intergenic
1024290167 7:47797424-47797446 CAGAGTTCTGAAATTTTGTGAGG - Intronic
1024319749 7:48052936-48052958 CAGCCATCTGCATTTATTGGAGG + Intronic
1027824631 7:83094722-83094744 CAGACATCTTCATTTTTCTGGGG + Intronic
1028248583 7:88512717-88512739 AAGATATCTGCATTTTTATTGGG - Intergenic
1028742687 7:94293896-94293918 AGGAGATCTGCATTTTGTAGTGG - Intergenic
1029869104 7:103669745-103669767 CATAGAACTGCATTTCCTTGGGG - Intronic
1030461939 7:109849682-109849704 CAGTGAGCTGCATTCTGTTGGGG - Intergenic
1030501262 7:110363232-110363254 CATAGATTTTCATTTCTTTGAGG + Intergenic
1030526725 7:110663353-110663375 CAAAGGTCTGCATATTTTGGGGG + Exonic
1030733133 7:113013822-113013844 CACAGATCTACATTTCTTTAGGG + Intergenic
1032698595 7:134359143-134359165 CAGAAAAGTGCTTTTTTTTGTGG + Intergenic
1033147032 7:138880077-138880099 CAAAGATCTGGAGTTATTTGGGG - Intronic
1034364881 7:150537365-150537387 CATAGATCTGCATTTCTGTAAGG - Intergenic
1035707077 8:1684255-1684277 CAGATACCTTCATCTTTTTGTGG + Intronic
1035841195 8:2813506-2813528 CAGAGTTCTGCTTTTATATGTGG - Intergenic
1037303279 8:17477145-17477167 CGTAGATCTCCATTTCTTTGAGG + Intergenic
1038064798 8:23952361-23952383 TAGGGAACTGCATTTGTTTGGGG - Intergenic
1039240399 8:35549813-35549835 CAGAATTCTGAATATTTTTGAGG + Intronic
1040917400 8:52577304-52577326 GAGAGATCTGTATTTTTCTGTGG + Intergenic
1041730767 8:61060472-61060494 CAAATTTCTGCATTTTTTTCAGG - Intronic
1043560522 8:81488306-81488328 CAGAGTTTTGCTTTTCTTTGGGG + Intergenic
1044451589 8:92342138-92342160 TATAGAACTCCATTTTTTTGAGG + Intergenic
1044906048 8:97004556-97004578 CAGATATTTGAATTTTTTTCAGG - Intronic
1045691778 8:104766736-104766758 CAGAGGTTTGCATTTTCTGGAGG + Intronic
1046214948 8:111131902-111131924 CACATATCTCCATTTTTTTAGGG - Intergenic
1047358912 8:124149796-124149818 TACAGATGTGCATTTTTCTGGGG - Intergenic
1047532745 8:125692144-125692166 CACAGTTATGCATTTTTTGGTGG + Intergenic
1047572672 8:126117279-126117301 CTGTGATCGGCAGTTTTTTGAGG - Intergenic
1047742590 8:127818589-127818611 CAGATGTCAGCAATTTTTTGTGG - Intergenic
1048058604 8:130893611-130893633 CAAAGATGTGGATTTTTTAGAGG + Intronic
1050006745 9:1140200-1140222 CATAGATCTTCATTTCTTTAGGG + Intergenic
1051245385 9:15105234-15105256 CATACATCTGCATTTCTTTAGGG - Intergenic
1051758622 9:20435113-20435135 CAGACATCTGCTTCTTTTAGTGG - Intronic
1052033177 9:23651316-23651338 CAGAGTTCTGGAAGTTTTTGTGG + Intergenic
1052116199 9:24651166-24651188 CATAGATCTCCATTTCTCTGGGG + Intergenic
1052155954 9:25190476-25190498 CAGTGCTCTTCATTTATTTGTGG + Intergenic
1054714538 9:68544071-68544093 CAGAGATCAGCATCGTTTTTAGG + Intergenic
1054721876 9:68611929-68611951 CAGATAGCTGTATTTTATTGTGG + Intergenic
1054805358 9:69391884-69391906 CAGAGTGCTCCTTTTTTTTGAGG - Exonic
1055182417 9:73403460-73403482 CAGAGACCTGGATTCTTGTGAGG - Intergenic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058349691 9:104007225-104007247 CAGAGATTTGCCTCTTTTGGGGG - Intergenic
1058525740 9:105856262-105856284 CAGAGATCTGAAATTGTGTGGGG + Intergenic
1058683536 9:107460845-107460867 CACAGATCTCCATTTCTTTAGGG - Intergenic
1058878837 9:109268930-109268952 CATATATGTGCATTTTTCTGGGG + Intronic
1058931268 9:109721542-109721564 CAGAGATTTTCTTTATTTTGGGG + Intronic
1058973487 9:110104163-110104185 AAGATTTCTGCTTTTTTTTGGGG + Intronic
1059207235 9:112478098-112478120 CCTAGATCTCCATTTCTTTGGGG - Intronic
1061516903 9:131095367-131095389 CCGAGATCATCATTTTTCTGTGG - Intergenic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1186804371 X:13125300-13125322 CAGAGATCTGAAAATTTGTGTGG - Intergenic
1188239948 X:27773758-27773780 CAGAGATCTGCTATGTTTTAAGG + Intergenic
1189200523 X:39191879-39191901 CAGAGCTCTGCAGCCTTTTGGGG - Intergenic
1191014864 X:55798245-55798267 CTGATTTTTGCATTTTTTTGTGG - Intergenic
1193552380 X:82911880-82911902 CATAGATCTGCATTTATTTAAGG - Intergenic
1194622755 X:96193628-96193650 CAAAGCTCTACCTTTTTTTGTGG + Intergenic
1194868952 X:99103074-99103096 GAGACATCTGCATTATATTGGGG + Intergenic
1195597584 X:106710369-106710391 CAGAGAACTACAGTTTATTGAGG + Intronic
1196169387 X:112570911-112570933 TAGAACTCTGCATTTTTTTTAGG - Intergenic
1196892155 X:120301718-120301740 TAGAGATCTGCATTTTTTGCAGG + Intronic
1197104141 X:122693799-122693821 TAAATATATGCATTTTTTTGAGG + Intergenic
1197329434 X:125135238-125135260 GAGTGATCTGCTTTTTATTGTGG - Intergenic
1198795744 X:140391963-140391985 TAGAGGTGTGCATTTTTCTGAGG - Intergenic
1198937453 X:141913431-141913453 TAGAGATCTGCCTTACTTTGGGG + Intergenic
1198961599 X:142189434-142189456 TAGAGATCTGCCTTACTTTGGGG - Intergenic
1200437797 Y:3173022-3173044 CATAGATCTCCATTAATTTGAGG + Intergenic
1200918382 Y:8591442-8591464 CAGTGTTCTTTATTTTTTTGTGG + Intergenic
1201985631 Y:19961736-19961758 AAGACATCTGTATTTTTTTTAGG - Intergenic