ID: 1064726254

View in Genome Browser
Species Human (GRCh38)
Location 10:18282725-18282747
Sequence ATATACTAGGTGAATGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064726254_1064726259 21 Left 1064726254 10:18282725-18282747 CCTTGTTCATTCACCTAGTATAT 0: 1
1: 0
2: 2
3: 15
4: 204
Right 1064726259 10:18282769-18282791 ATAAAGACAGTCCCTAGACTGGG No data
1064726254_1064726258 20 Left 1064726254 10:18282725-18282747 CCTTGTTCATTCACCTAGTATAT 0: 1
1: 0
2: 2
3: 15
4: 204
Right 1064726258 10:18282768-18282790 GATAAAGACAGTCCCTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064726254 Original CRISPR ATATACTAGGTGAATGAACA AGG (reversed) Intronic
902431780 1:16368640-16368662 AAATGCTGGTTGAATGAACAAGG - Intronic
906875370 1:49532480-49532502 ATTTACTTGGATAATGAACAAGG - Intronic
906888876 1:49685175-49685197 ATATCCTAAGTGAATTAACATGG - Intronic
908833562 1:68206072-68206094 ACATCCTATGTGAATCAACAGGG - Intronic
910043918 1:82888645-82888667 ATATACTAGGTAATAAAACAAGG - Intergenic
913455630 1:119027683-119027705 GTATATTAGGTGAATCCACATGG + Intergenic
914426193 1:147579190-147579212 ATATGCTAGTTGAGTGACCAAGG + Intronic
914943174 1:152040517-152040539 ATTCACCAGGTGGATGAACATGG + Intronic
916516497 1:165522924-165522946 ATATAATAGGTAAAGGAATATGG - Intergenic
916588693 1:166169279-166169301 ATTTACTTGGTAACTGAACAAGG + Intergenic
916648414 1:166812236-166812258 TTATCCTAGGCAAATGAACACGG + Intergenic
916679615 1:167092377-167092399 ATATAATAAGAGAATTAACAAGG - Intergenic
917452181 1:175156348-175156370 ATGTCCTGGGTGGATGAACAAGG + Intergenic
918034703 1:180856596-180856618 ATAAACTAGGTTAGAGAACATGG - Intronic
918988670 1:191667664-191667686 ATATAGTAGGTGAAGAAATATGG - Intergenic
919122151 1:193354470-193354492 ATCTGCTAGATGAATGAACTTGG + Intergenic
924311262 1:242745473-242745495 TGATACTAGGGGACTGAACAAGG + Intergenic
1062818537 10:517339-517361 AGACATTAGGTGAAGGAACAAGG + Intronic
1064726254 10:18282725-18282747 ATATACTAGGTGAATGAACAAGG - Intronic
1066401016 10:35076145-35076167 TTCTACTAAGTGAATGAAGAGGG + Intronic
1066401124 10:35077218-35077240 TTCTACTAAGTGAATGAAGAGGG + Intronic
1069344198 10:67447821-67447843 ATATAAGAGGTGAATGAAACAGG - Intronic
1072700296 10:97636085-97636107 ATTTACCAGCTGAATGACCATGG + Intronic
1073257081 10:102159560-102159582 ATAAACCAGGTGACTGGACATGG + Exonic
1076055907 10:127372705-127372727 AGAAAGTAGGTGATTGAACATGG + Intronic
1078344110 11:10528676-10528698 ATATACTGTGTCAATAAACAAGG + Intronic
1078566681 11:12420824-12420846 ATTTACTAGCTGTGTGAACATGG - Intronic
1078741574 11:14071568-14071590 ATGTTCTAGGAGAAGGAACAGGG - Intronic
1078963172 11:16303727-16303749 ATGTACTAGGAGACTCAACATGG - Intronic
1079782411 11:24624148-24624170 TTATACTAGCTGAGTGAACCTGG - Intronic
1081272037 11:41096697-41096719 ATATACAATGTGAATGCAAACGG + Intronic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1085497673 11:76986553-76986575 ATATAGTAAGTGATTGAAAATGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1089551272 11:119280573-119280595 TTATAGTTGGTGAATGCACATGG + Intronic
1090796579 11:130140832-130140854 AAATACTAGGTGAATAAAAGGGG - Intronic
1091076794 11:132626140-132626162 CTATACTAGATGCATGAACAGGG + Intronic
1091178913 11:133585699-133585721 ATTGGCTAGGTGAATGCACATGG - Intergenic
1093336697 12:17913190-17913212 ATAGAATAAGTGCATGAACAAGG + Intergenic
1096254758 12:50056266-50056288 ATTTACTAGGGGACTGGACACGG - Intergenic
1097456959 12:59811300-59811322 ATATATGAGGGGAATGAGCATGG + Intergenic
1099081931 12:78194509-78194531 AGATACTAAGGGACTGAACAAGG - Intronic
1099198169 12:79643912-79643934 AATTACTAGGTGAACAAACATGG + Intronic
1099510024 12:83523502-83523524 ATAAATGAAGTGAATGAACAAGG + Intergenic
1100796541 12:98187703-98187725 AAAAACTAGGTGGATGACCAGGG + Intergenic
1100945271 12:99776427-99776449 ACCTATTAGCTGAATGAACATGG - Intronic
1105058266 12:133123944-133123966 ATTCACTAGGTGAATCACCATGG + Intronic
1108694776 13:52893340-52893362 ATATAGTAGGTGATTTACCAGGG + Intergenic
1109939350 13:69340005-69340027 ATACATTTGGTGAATGAAAATGG - Intergenic
1110097929 13:71554785-71554807 ATATACTAGGTTGATGATCTAGG - Intronic
1110114418 13:71794333-71794355 AAATCCTAGGTGAATTAACATGG + Intronic
1110475738 13:75911111-75911133 ATGTACTCAGTGAATGATCACGG + Intergenic
1112219139 13:97470400-97470422 AAATAATAGCTGAATGAGCATGG - Intergenic
1114457047 14:22862382-22862404 ATTTATCAGGTGAATGAACTTGG - Intergenic
1115573688 14:34690717-34690739 TTATACTAGGTGCATGACCTTGG - Intergenic
1116328335 14:43562912-43562934 CTACGCTAGGTGAAAGAACACGG + Intergenic
1117155820 14:52939650-52939672 ATATACTAGCTGTATGACCTTGG - Intronic
1120162636 14:81162307-81162329 ACACACTAGGTAAATGAACAAGG + Intergenic
1120266985 14:82263806-82263828 ATATTCTAGGGAAAAGAACATGG + Intergenic
1120951122 14:90042869-90042891 GGACACTAGGTGAGTGAACATGG - Intronic
1124170614 15:27369487-27369509 ATATCTTTGGTGTATGAACATGG + Intronic
1125119226 15:36133340-36133362 ATCTACTAGCTGTATGAACTTGG - Intergenic
1125150730 15:36529317-36529339 ATATATTATATGAATCAACAAGG + Intergenic
1125835421 15:42746393-42746415 ATATACTAGTTGTATGACCCTGG + Intronic
1126847507 15:52774651-52774673 AGATACAAGGTGCTTGAACATGG + Intronic
1126914662 15:53452630-53452652 ATATACTAGGACAATAAAAAGGG - Intergenic
1127203438 15:56684854-56684876 ATATACAGGTTGAAAGAACAAGG + Intronic
1127296593 15:57614219-57614241 AAATACTTGCTGAATGAATAGGG - Intronic
1129161090 15:73748357-73748379 ATATGCTTGGTGAAAGAACAAGG - Intronic
1130164860 15:81444094-81444116 ATATAATAGGGGATTGAAAAGGG - Intergenic
1134363656 16:13556292-13556314 ATCTACTAGTTGTATGAACTTGG - Intergenic
1135078172 16:19411790-19411812 AAATACTTGTTGAATGAATAAGG + Intronic
1135244152 16:20840289-20840311 ATATAGTATGGGAATGAATATGG - Intronic
1138926319 16:61595717-61595739 ATTTTGTAGGTGAATGAACTAGG - Intergenic
1139723421 16:68875915-68875937 ATAAACAAGGTAAATTAACATGG + Intronic
1140672180 16:77290300-77290322 ATATATTAAGCAAATGAACATGG + Intronic
1141012871 16:80419195-80419217 ATATTCTAGGGGAAAGCACATGG - Intergenic
1144390843 17:14792032-14792054 ATACTCAAGGTGAAGGAACATGG - Intergenic
1145905711 17:28515003-28515025 ATATACTAGCTGAGTGAACTTGG + Intronic
1150450518 17:65263249-65263271 TTATCCTAAGTGAATTAACACGG + Intergenic
1153784178 18:8519705-8519727 ATTTAGTAGGAAAATGAACAAGG + Intergenic
1156080849 18:33333244-33333266 ATAGACTACATGAATGAACATGG - Exonic
1156690364 18:39700255-39700277 ATATCCTAGGTGGAAGAAAAAGG - Intergenic
1157332068 18:46711394-46711416 ATTTACTAGCTGAATGACCTTGG - Intronic
1158078414 18:53559936-53559958 TTATCCTAGGTGAACTAACATGG + Intergenic
1158285715 18:55880152-55880174 CTCTACTAGTTCAATGAACAGGG + Intergenic
1159097767 18:63923873-63923895 ATTGAATAGTTGAATGAACACGG - Intronic
1159802063 18:72913525-72913547 ACATACTAGGTGAACAAATATGG + Intergenic
1160184114 18:76661248-76661270 GTCTACTAGGTGAAGGAAAAAGG + Intergenic
1164320548 19:24140490-24140512 ATATAGTAAGTGACTGAACCTGG - Intergenic
1167977962 19:53246584-53246606 ATAGACTACCTGAATGAAAATGG + Intronic
1168606380 19:57763377-57763399 ATGCACCAGGTGAATGAACCTGG + Intergenic
933406359 2:81865188-81865210 ATAGACTAGGTGACTGAAACAGG + Intergenic
934151836 2:89154496-89154518 AAATACTAGGAAAATCAACAGGG - Intergenic
934215424 2:90027410-90027432 AAATACTAGGAAAATCAACAGGG + Intergenic
935013750 2:99159686-99159708 AAATACTTGTTGAATGAATATGG + Intronic
939528454 2:143326493-143326515 AAAGACTCAGTGAATGAACAAGG - Intronic
939678322 2:145099459-145099481 ATGTACTAGCTGAGTGAACCAGG + Intergenic
939789554 2:146554993-146555015 ATATAGGAGGTGAATATACAAGG - Intergenic
939842698 2:147207814-147207836 ATCTAGTAGGTAAAAGAACAGGG + Intergenic
944652864 2:201849089-201849111 ATTTTCTAGCTAAATGAACATGG + Intronic
946018738 2:216624847-216624869 ACATACTAGTTGGATGACCACGG + Intergenic
946995500 2:225386391-225386413 ATTTTCTAGGTGAATGTACCTGG + Intergenic
1172039445 20:32033708-32033730 ATATATTAGGTGAATATACCTGG - Intergenic
1173116659 20:40249790-40249812 ATCTGCTAGTTGAATGACCATGG + Intergenic
1174679267 20:52389520-52389542 ATTTATTAGGAGAATGAATATGG + Intergenic
1177060772 21:16371689-16371711 ATATACTAGCTGAATGATCATGG + Intergenic
1177298005 21:19202220-19202242 AAAAATTAGGTGAATGACCATGG + Intergenic
1177805970 21:25875142-25875164 ATTTACAAAGAGAATGAACAAGG + Intergenic
1178378463 21:32088588-32088610 ACTTACTAGCTGAGTGAACATGG - Intergenic
1179261287 21:39760208-39760230 ATGTACTGAGTGAATAAACATGG - Intronic
1181891349 22:26066430-26066452 ATATCAGAGGTGAAAGAACATGG - Intergenic
950824462 3:15802817-15802839 GTATACTAGGTGAATGGATGGGG - Intronic
951631907 3:24731292-24731314 TTATTCTAAGTGAATTAACAAGG + Intergenic
951667266 3:25141300-25141322 ATATACTAGATGAATAAGGATGG + Intergenic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
955256014 3:57332165-57332187 TTAAACTAGATGTATGAACATGG + Intronic
955269981 3:57487708-57487730 ATAAACTAGGTGAAGGAAACTGG + Intronic
957204150 3:77173047-77173069 ATAGACAAGGTAAATCAACATGG + Intronic
959993677 3:112656965-112656987 TTATCCTAAGTGAATTAACACGG - Intergenic
960750967 3:120952764-120952786 ATATCCTTGGTCAATGAATAAGG + Intronic
963331120 3:143917506-143917528 ATATACTAGGTGAAAGGAATGGG + Intergenic
965385457 3:168040199-168040221 ATATATTTACTGAATGAACAGGG - Intronic
970330674 4:14980713-14980735 ATTTACTAGGTGTGTGAACTTGG + Intergenic
971990573 4:33887615-33887637 AAATACAAGGGGAAAGAACATGG + Intergenic
972886359 4:43494466-43494488 TTTTATTAGGTGAATGAATATGG - Intergenic
973269813 4:48251142-48251164 ATATACTAGGTTAAGGAGTATGG - Intronic
974257271 4:59475260-59475282 ATATACTTGGTGAAAGATAAAGG + Intergenic
975331203 4:73115700-73115722 AAATACTAGATAAATGAAAATGG + Intronic
975987520 4:80215475-80215497 ATATACGAGGGGAATAGACAGGG - Intergenic
977467958 4:97405275-97405297 ATGTACTAAGTACATGAACAAGG + Intronic
977595094 4:98870485-98870507 ATATAATAGGTGAAATAAGAGGG - Intergenic
977602050 4:98944070-98944092 ATAAATTAGGTAAATGAAAAGGG + Intergenic
979409065 4:120352204-120352226 ATATACTAAATGTATGAACAGGG - Intergenic
980461474 4:133120662-133120684 ATGTACTAGATGAGTGAAAAAGG - Intergenic
982891797 4:160863430-160863452 AGATACTAGGTTGATGAAGACGG - Intergenic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
984118216 4:175708756-175708778 ATATAATAGGTGAAGGTATAGGG + Intronic
984595616 4:181664096-181664118 ACATACTAGCTGAATGATCCAGG + Intergenic
985072142 4:186176787-186176809 ATCTGCTAGGTGAATGGACAAGG + Intergenic
986412670 5:7496491-7496513 ATATAATAGCTGAATGAATTCGG + Intronic
987548764 5:19350623-19350645 ATATATTAGGTATATGAAGATGG - Intergenic
988878957 5:35479263-35479285 AAATATTTGTTGAATGAACAAGG + Intergenic
990561382 5:56986781-56986803 ACAGACTGGGTGAATGCACATGG + Intergenic
990957639 5:61359512-61359534 GTACACCAGGTGAATGAAGATGG + Intronic
992240190 5:74761150-74761172 ATATCCTAGGGGAAAGAATAAGG + Intronic
994407613 5:99364948-99364970 ATATCCTTGGAGAATAAACAAGG + Intergenic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
996249206 5:121306951-121306973 TTATACTAAGAGAATGAAGAGGG - Intergenic
999791842 5:154947229-154947251 ATTTACTAGGTGAATGGCCTTGG - Intronic
999799876 5:155023512-155023534 CTAAACCAGGTGAATGCACAAGG - Intergenic
1001171287 5:169421729-169421751 ATATATTAAGTGAAAAAACATGG + Intergenic
1006257264 6:32841704-32841726 CTCTACTACGTGGATGAACATGG - Exonic
1007965308 6:45999038-45999060 ATATACTTGGTGAATGGCCTTGG - Intronic
1008174919 6:48255918-48255940 AGTTACTAAGTGAACGAACAAGG - Intergenic
1010885295 6:81230403-81230425 AGATAATAGGTAAATTAACATGG + Intergenic
1011090710 6:83595765-83595787 ATATACTAAGTAAATCACCAAGG - Intronic
1011828886 6:91345450-91345472 ATAGCCCAGGTGAATAAACAAGG - Intergenic
1011992011 6:93533393-93533415 ATGAATTAGGAGAATGAACATGG - Intergenic
1013021288 6:106222315-106222337 ATATACTACATGCATGAGCATGG + Intronic
1014145087 6:117988193-117988215 ATTTATTAAGTGAATGAACTTGG + Intronic
1014507237 6:122274408-122274430 ATTTACTAAGTGACAGAACAAGG + Intergenic
1014944469 6:127480305-127480327 ATATACCAGCTGTATGAACTTGG - Intronic
1015945713 6:138498494-138498516 TTATACTGGATAAATGAACATGG - Intronic
1016473121 6:144396607-144396629 ATATAGTAGGTGAATTTAAATGG + Intronic
1016797453 6:148133110-148133132 ATGTACTAGGTGATTGAGTATGG + Intergenic
1018028204 6:159821987-159822009 AGAGAAGAGGTGAATGAACAAGG - Intergenic
1018424436 6:163667607-163667629 ATATATTAAATGAATGAATAGGG - Intergenic
1018965303 6:168481308-168481330 ACATAGTAGCAGAATGAACAGGG + Intronic
1020533268 7:9361452-9361474 ACTCACTGGGTGAATGAACAAGG - Intergenic
1021022839 7:15625128-15625150 ATATAGTAGATGAAGGAACTAGG - Intronic
1021879507 7:25080717-25080739 GTAAACTAGGTGAATGTAAATGG - Intergenic
1023502846 7:40868935-40868957 AGAAACTGGGTGAATGTACATGG - Intergenic
1027411075 7:77918416-77918438 ATAAATTAGGTGAAAGAAGATGG - Intronic
1027641243 7:80736047-80736069 TTATCCTAAGTGAATTAACATGG + Intergenic
1027686238 7:81281558-81281580 ATTTATCATGTGAATGAACATGG + Intergenic
1029945503 7:104528543-104528565 AAGAACTAGTTGAATGAACAAGG + Intronic
1030250910 7:107443226-107443248 ATATACTAAGTGAAAGAGCCCGG + Intronic
1030624234 7:111826607-111826629 TTATCCTAAGTGAATTAACATGG + Intronic
1030625070 7:111836012-111836034 ATATACTTTGTTAATGAACATGG + Intronic
1032656056 7:133930880-133930902 ATATACTAGGTGATTACACAAGG - Intronic
1033907794 7:146226988-146227010 TTATACTAAATGAATGAAAAAGG + Intronic
1033990969 7:147286774-147286796 ATATGGTAGGTGAATGGAAAGGG - Intronic
1034033566 7:147795744-147795766 ATTAACTAGTTGAATGATCATGG + Intronic
1036124038 8:6046875-6046897 AAATGCTGGTTGAATGAACAAGG - Intergenic
1036920229 8:12845723-12845745 ATATACTATATGAATCAACCAGG - Intergenic
1039530329 8:38255635-38255657 ATATACTAGTAGAAAAAACAAGG - Intronic
1041210576 8:55546759-55546781 ATTTATTATGTGAATGGACAGGG - Intergenic
1044084725 8:87930275-87930297 ATATTATTTGTGAATGAACATGG + Intergenic
1044689633 8:94863900-94863922 CTATACTAGGTGAATAGACATGG - Intronic
1046319241 8:112549323-112549345 ATATAATAGGTGAATATAAATGG - Intronic
1047171609 8:122498561-122498583 ATAAACTAGGTTAAGGAAAATGG - Intergenic
1047345812 8:124027276-124027298 ATATACTAGTTGTATGACCTTGG + Intronic
1048057423 8:130881236-130881258 AAATACTTGTTGAATGAATAAGG - Intronic
1048407056 8:134134247-134134269 ATATACTATGTGAATGTCTAAGG + Intergenic
1049839716 8:144763167-144763189 ACATACTTGCTGAATGGACAAGG - Intergenic
1049937842 9:516730-516752 AAATACTTGTTGAATGAATATGG + Intronic
1050580211 9:7046527-7046549 ATATACTAGGTGTGTGGACTAGG + Intronic
1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG + Intronic
1053360095 9:37479602-37479624 TTATACTATATGAATGAAGATGG + Intergenic
1057698409 9:97344268-97344290 ATACAGGAGGTGAATGAACCAGG - Intronic
1057866437 9:98685485-98685507 ATATACTTGTTGAATGAATAAGG + Intronic
1058457750 9:105153785-105153807 ATTTACTAGCTGCATGAACTTGG - Intergenic
1058505969 9:105666434-105666456 AAATACTTGGTGGCTGAACAGGG - Intergenic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1059929149 9:119243855-119243877 ATATACCAGGTGAATAGCCAAGG + Intronic
1060296890 9:122348984-122349006 AAATACTGGCTGAAAGAACAAGG + Intergenic
1186904979 X:14101181-14101203 TTATCCTAAGTGAATTAACACGG - Intergenic
1187194062 X:17064896-17064918 TTATACTAAGTGAAAGAATACGG - Intronic
1188394421 X:29662977-29662999 ATTTACTAGGTGAATCCACTTGG - Intronic
1188653278 X:32658467-32658489 ATACATTAAGTGAATAAACATGG + Intronic
1189063280 X:37777524-37777546 ATATGCTAAGTGAGTAAACAGGG - Intronic
1189753323 X:44245513-44245535 TTATTTTATGTGAATGAACACGG - Intronic
1193210233 X:78798778-78798800 ACATACTAGCTGCATGAACATGG - Intergenic
1194638987 X:96379637-96379659 ATCTACAAAGTGAATAAACAAGG + Intergenic
1195158681 X:102149714-102149736 TTATACTAGGTGAAAGAAGCCGG + Intergenic
1197173382 X:123458858-123458880 ATATGCCTGGTGAATGACCAGGG - Intronic
1197649671 X:129051038-129051060 ATATAGTAGGTGAGTGAAACAGG - Intergenic
1198473485 X:136972697-136972719 ACTTACTAGCTGAATGACCATGG - Intergenic
1199327692 X:146519581-146519603 AAATACTAGATGAATCAAAATGG - Intergenic
1199489709 X:148384803-148384825 ATATTCTAGTTGTATGATCATGG + Intergenic
1201249037 Y:12037337-12037359 TTATTCTAAGTGAATTAACACGG + Intergenic