ID: 1064730161

View in Genome Browser
Species Human (GRCh38)
Location 10:18322231-18322253
Sequence TGATTTCCAAATTAACATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064730159_1064730161 17 Left 1064730159 10:18322191-18322213 CCCTCAAACAGAAATCTTAGAAA 0: 1
1: 0
2: 2
3: 37
4: 420
Right 1064730161 10:18322231-18322253 TGATTTCCAAATTAACATCTTGG No data
1064730160_1064730161 16 Left 1064730160 10:18322192-18322214 CCTCAAACAGAAATCTTAGAAAT 0: 1
1: 0
2: 1
3: 41
4: 455
Right 1064730161 10:18322231-18322253 TGATTTCCAAATTAACATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064730161 Original CRISPR TGATTTCCAAATTAACATCT TGG Intronic
No off target data available for this crispr