ID: 1064731279

View in Genome Browser
Species Human (GRCh38)
Location 10:18333265-18333287
Sequence CAATTCAGCAGCTTCAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064731279_1064731284 7 Left 1064731279 10:18333265-18333287 CCTTATCTGAAGCTGCTGAATTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1064731284 10:18333295-18333317 GATTGATCATGGCTTCTTAGAGG No data
1064731279_1064731283 -4 Left 1064731279 10:18333265-18333287 CCTTATCTGAAGCTGCTGAATTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1064731283 10:18333284-18333306 ATTGCAGGCGGGATTGATCATGG No data
1064731279_1064731288 26 Left 1064731279 10:18333265-18333287 CCTTATCTGAAGCTGCTGAATTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1064731288 10:18333314-18333336 GAGGGATAAACTCTGAGGAAGGG No data
1064731279_1064731286 21 Left 1064731279 10:18333265-18333287 CCTTATCTGAAGCTGCTGAATTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1064731286 10:18333309-18333331 TCTTAGAGGGATAAACTCTGAGG No data
1064731279_1064731287 25 Left 1064731279 10:18333265-18333287 CCTTATCTGAAGCTGCTGAATTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1064731287 10:18333313-18333335 AGAGGGATAAACTCTGAGGAAGG No data
1064731279_1064731285 8 Left 1064731279 10:18333265-18333287 CCTTATCTGAAGCTGCTGAATTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1064731285 10:18333296-18333318 ATTGATCATGGCTTCTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064731279 Original CRISPR CAATTCAGCAGCTTCAGATA AGG (reversed) Intronic
900910056 1:5590040-5590062 TAATTCAGCAGATGCAGAAAAGG + Intergenic
901465958 1:9421370-9421392 GAATACACCAGCTTCAGGTATGG + Intergenic
907151199 1:52289611-52289633 GAATTCAAGAGCTTCAGATTAGG + Intronic
908643520 1:66251572-66251594 AATTTTAGCAGTTTCAGATAAGG + Intronic
909507696 1:76412423-76412445 CAATAAAGCTGCTTCAGAGAGGG - Intronic
911284583 1:95974608-95974630 AAATCCAGCAGCTCCAGTTAGGG - Intergenic
911462359 1:98206713-98206735 AAATTCAGGATCTTCAGATGAGG - Intergenic
911500589 1:98680238-98680260 CACTCCAGCTGCTTCAGCTATGG - Intronic
912122698 1:106492245-106492267 TAATTCAGCAGCTTCAGTCTGGG + Intergenic
915606457 1:156955070-156955092 CAATGCAGCAATTTCAGAAAGGG + Intronic
919199562 1:194337307-194337329 AAATTCAGCATCATCAGTTAGGG - Intergenic
922056649 1:222048597-222048619 CCATTCAGCAGTTTCAATTAAGG - Intergenic
924743008 1:246808332-246808354 CAATTCATCAACTTTATATATGG - Intergenic
1063646513 10:7889133-7889155 CAAGTCTGCAGTTTCAGAGAAGG - Intronic
1064731279 10:18333265-18333287 CAATTCAGCAGCTTCAGATAAGG - Intronic
1065376227 10:25045233-25045255 CATTCTACCAGCTTCAGATAAGG - Intronic
1066267650 10:33791785-33791807 CAAATCAGCAGCTTCTGGCATGG + Intergenic
1069348309 10:67495889-67495911 CACTTCCACAGCTTCAGAGATGG + Intronic
1071148228 10:82600358-82600380 CAATTCAGCTGTTTGAAATAGGG - Intronic
1079295799 11:19232990-19233012 GAATTCAGAACCTTCTGATATGG - Intronic
1080258923 11:30324131-30324153 CAAATCAGGAGCTTTAGTTATGG - Intronic
1081759557 11:45567765-45567787 CAAATTTGCAGCTTCAGAAAGGG + Intergenic
1085236144 11:75017105-75017127 CAAGTCAGCATCTTCATATAAGG - Intronic
1087057805 11:93950743-93950765 GAATTCAGTAGGTACAGATATGG - Intergenic
1088076050 11:105849630-105849652 CAGTGCAGAAGCCTCAGATAAGG + Intronic
1093111031 12:15152317-15152339 CAATTCACCTGCCTTAGATATGG + Intronic
1094249147 12:28339480-28339502 CAAATCTGCAGATACAGATAAGG - Intronic
1099067907 12:78006785-78006807 CATTTCACCAGATTCAGAAAAGG - Exonic
1099649498 12:85406531-85406553 CAATTAATGAGCTTCAGAAAAGG + Intergenic
1109843867 13:67958090-67958112 GAATTCAGCAGATTCTGATAAGG - Intergenic
1110397987 13:75054445-75054467 TAAATCAGAATCTTCAGATATGG + Intergenic
1112627214 13:101118977-101118999 CTATTCAGCAACTTTGGATAAGG - Intronic
1114382496 14:22222342-22222364 CAATTCACCAGCCTTATATAAGG - Intergenic
1116174772 14:41454360-41454382 CAATGCATCAACTTCAGATGTGG - Intergenic
1118657912 14:67973111-67973133 CCTTTCAGCAGCCTTAGATATGG - Intronic
1121800941 14:96773743-96773765 CAATTCAGAATCCTCAGAGAAGG + Intergenic
1122573708 14:102726828-102726850 CCAGTCAGCAGCTTCAGAGCAGG + Exonic
1126947709 15:53842400-53842422 CAATTCATGATGTTCAGATAGGG + Intergenic
1127496281 15:59515449-59515471 CAATTCAACAGCTCCACATCTGG - Intronic
1130668828 15:85892280-85892302 CAATTAAGCAGCTTCAGTTGTGG + Intergenic
1131772402 15:95753243-95753265 CAATTTATCAGTTTGAGATACGG - Intergenic
1136053682 16:27672119-27672141 CCCTTCAGCAGCTTCTCATAGGG + Intronic
1138045127 16:53714350-53714372 CAATTCAGCAGAGTGAGTTAAGG - Intronic
1138059106 16:53870413-53870435 CAATTCAGTAGTTACAGTTACGG + Intronic
1138157680 16:54721113-54721135 CACTCCAGCAGCTTCATAGAGGG + Intergenic
1141378638 16:83555142-83555164 CAGTTCAGCAGCTTGAAAGAGGG + Intronic
1142661643 17:1434234-1434256 CAATTCACCTGCATCAGAGATGG + Intronic
1142784874 17:2213343-2213365 CCAAGCAGCAGCTTCAGAGAAGG + Intronic
1143736419 17:8914772-8914794 CAAGTCAGCAGCTCCAGATTGGG + Intronic
1147534819 17:41313189-41313211 CAACTCGGCAGTTTCACATAAGG + Intergenic
1147651217 17:42062988-42063010 GCACTCAGCAGCTCCAGATATGG + Exonic
1149833579 17:59892879-59892901 CAATTTACGAACTTCAGATATGG + Exonic
1151459171 17:74244447-74244469 CAAAGCAGCAGCTTCTGATGCGG - Intronic
1151994602 17:77600708-77600730 CAATTCACCTGCTTCAGGTGAGG - Intergenic
1153623679 18:7003674-7003696 CTATTCAGCTGCATCAGACATGG - Intronic
1155279867 18:24228463-24228485 GAATTCAGCAGCATCAGATGTGG - Intronic
1156822634 18:41391312-41391334 CATTTCAGCAGCTGGAGAGAAGG - Intergenic
1156912702 18:42429397-42429419 CAATGCAGCAGCAGCGGATATGG - Intergenic
1158249571 18:55472119-55472141 CATTTCTGCTGCTTAAGATATGG + Intronic
1158325193 18:56306314-56306336 CCATTCAGCATCTTCAGGAAGGG + Intergenic
1163264264 19:16208877-16208899 GATTTCAGCAGCTCCAGAAAAGG - Intronic
1165559957 19:36670614-36670636 CAATTCAGTAGCTACACATCAGG - Intergenic
1165761093 19:38321450-38321472 CAATTCAGCAGCCCCAGCTAGGG + Intronic
1167069240 19:47210209-47210231 CACTTCAGAAGCTTCTGAGAGGG + Intronic
926802998 2:16678457-16678479 CAAATCAGTAGCTTCAATTAGGG - Intergenic
928969055 2:37007755-37007777 CAGTTCATCAGCTACAGAAAAGG - Intronic
931580897 2:63772691-63772713 CAATTCAGTAGATGCAGAAAAGG + Intronic
932593200 2:73079453-73079475 CAAGACAGCAGCTTCAGAGGTGG + Intronic
933629062 2:84635802-84635824 CCATTCAGCAGCAGCAGAAATGG + Intronic
936579107 2:113680952-113680974 TCATTCAGTAGCTTGAGATAGGG - Intergenic
937700023 2:124853501-124853523 CAGTTCTACAGCTTCAGGTACGG + Intronic
940976614 2:159952863-159952885 CAATACAGCAGCTGTACATATGG + Intronic
941017045 2:160369374-160369396 CAACTCAGTGGCTTCAGAGAAGG - Intronic
942033074 2:171982431-171982453 CAAGTCAGCAGCAGCAGAGATGG - Intronic
943529976 2:189067211-189067233 GAATTTAGCAACTTCAAATAGGG + Intronic
943569420 2:189555761-189555783 AAAACCAGCAGCATCAGATAGGG - Intergenic
944825272 2:203476917-203476939 CAAATAAGCAACTTTAGATATGG - Intronic
944830865 2:203533554-203533576 GATTTCAGCAGATTCAGATGGGG - Intronic
946388265 2:219399434-219399456 CAAATCAGGAGTTTCAGGTATGG - Intronic
1168870858 20:1127036-1127058 CACATCAGCAGCTTAAGAGAAGG - Intronic
1169257814 20:4112030-4112052 CAAGGCAGCAGCTTCAGGAATGG - Intergenic
1169257939 20:4112824-4112846 CAAGGCAGCAGCTTCAGGAATGG - Intergenic
1170771991 20:19340921-19340943 CAAGTCAGCTGCTTCACAAAAGG - Intronic
1171193144 20:23175448-23175470 CAATGCAGCTGCTTCATATTGGG - Intergenic
1174549378 20:51350643-51350665 AAATTGAGCATCTTCAGATTTGG - Intergenic
1175320911 20:58087621-58087643 CAATTGAGCTGCATCAGACATGG - Intergenic
1175688663 20:61049910-61049932 CAATTCAGCAGCTGGAGGTGGGG + Intergenic
1178504511 21:33151932-33151954 CGAGTCACCAGCTTCAGAAAAGG + Intergenic
1183835036 22:40445453-40445475 CAATTGAGGAAATTCAGATATGG - Intronic
1184633184 22:45802447-45802469 CAATACAGCACCTTCAGGAAGGG - Intronic
1184762437 22:46552151-46552173 CAAGTCATCAGCGTCAGACAGGG + Intergenic
952594209 3:34995788-34995810 CACTACAGCTGCTTCAGCTATGG + Intergenic
952758547 3:36893619-36893641 CTCTTCAGCAACTTTAGATAGGG - Intronic
953231887 3:41072650-41072672 CTATTCAGGAACTTCAGAAAGGG + Intergenic
956429515 3:69171446-69171468 CAATTCAGCAGGATGAGAGAAGG - Exonic
961760507 3:129163907-129163929 CAGTTAAGAAGCTTGAGATAGGG + Intergenic
961908746 3:130291361-130291383 CAATTCAGCAACATAAGAAAAGG - Intergenic
964055886 3:152456603-152456625 CATTTTAGTAGCTTCAGAAATGG - Intronic
969498036 4:7537230-7537252 CAATTCAGCTGCTTCATCTAAGG - Intronic
969690642 4:8702285-8702307 CAATTCAGCAGCCACAGGCAGGG - Intergenic
970130223 4:12861254-12861276 CAATGCAGGGGATTCAGATATGG - Intergenic
970358032 4:15277375-15277397 CAATTCATCAATTTCAGGTAAGG - Intergenic
970374483 4:15442774-15442796 CAATTCATCATCTTCTGATATGG - Exonic
973817325 4:54631082-54631104 TAATTCAGTATCTTGAGATAGGG - Intergenic
974054671 4:56973638-56973660 CCATGCAGCAGCTTTAGATTAGG - Intronic
974263247 4:59552042-59552064 CAAATCAGCAGTTTCTGATAAGG - Intergenic
974482509 4:62464590-62464612 CAATTAAGAATCTTGAGATAAGG + Intergenic
974482582 4:62465454-62465476 AAATTAAGAATCTTCAGATAGGG - Intergenic
976807644 4:89066030-89066052 CAATTGGACAGGTTCAGATATGG - Intronic
977704659 4:100057863-100057885 CAATTCAGAAGCTGATGATAAGG + Intergenic
979069050 4:116177836-116177858 CAATTCATTAACTTCAGAAAAGG + Intergenic
979521051 4:121666775-121666797 CAAAACAGCAAGTTCAGATATGG - Intergenic
983097565 4:163582107-163582129 CAATTCTTCAGCTTCAGAATAGG + Intronic
986618027 5:9639659-9639681 CAATTCAGAAGATTTAGCTAAGG - Intronic
986649138 5:9946651-9946673 CAACTCAGCATCTTGAGATGGGG + Intergenic
987839822 5:23209181-23209203 CAATTCAGCTCCTTCAGCAATGG + Intergenic
991055915 5:62320269-62320291 CTATGCAGCAGCTACAGATTAGG - Intronic
991946322 5:71901395-71901417 CAATCCAGCTGCTTCAGTGATGG - Intergenic
992532068 5:77661817-77661839 AAATGAAGAAGCTTCAGATAAGG - Intergenic
992832463 5:80607423-80607445 AAACTCAGCAGCTTCATAGATGG - Intergenic
993700276 5:91111065-91111087 CCATTTAGCAGCTTAAGACATGG - Intronic
1006538925 6:34723482-34723504 CATTGCAGCAGCCTCAGTTATGG + Intergenic
1008692652 6:53998410-53998432 CACTACAGAAGCATCAGATAGGG + Intronic
1008893273 6:56521110-56521132 TAATTCAGCAGCTTCAGGTGTGG + Intronic
1011335289 6:86253217-86253239 CCATTAAGCAGCTCCAAATAAGG - Intergenic
1013151201 6:107448033-107448055 CATCTCAGCAGCTTCAGCAATGG - Intronic
1021636661 7:22700567-22700589 CACTTCAGGAGATTCTGATATGG - Intergenic
1022328335 7:29353743-29353765 TAGTTCAGCACCTTTAGATATGG - Intronic
1022426878 7:30277495-30277517 AAATTCAGAATCTTGAGATAGGG - Intergenic
1024712328 7:52030166-52030188 TATTTCAGCAGCTTGAGAGATGG - Intergenic
1027460653 7:78448963-78448985 CGATTCAGCAGGTGAAGATATGG + Intronic
1027499410 7:78929729-78929751 AAATTAAGGATCTTCAGATAGGG - Intronic
1031771311 7:125847978-125848000 CATTCCAGCAGCTTCAGCTCTGG + Intergenic
1033142428 7:138839744-138839766 CAATTTAGCAGCTTCTGCTTTGG - Intronic
1033578487 7:142709839-142709861 TAATTCAGCAGCCTGAGATAGGG + Intergenic
1034859164 7:154581464-154581486 CACCTCAGCAGCTTCAGAACAGG + Intronic
1040556112 8:48478734-48478756 CAATTCAGCAGCCACTGATCAGG - Intergenic
1043078891 8:75739729-75739751 AAATTCAACAGTTTCAAATAAGG + Intergenic
1043657880 8:82694854-82694876 CAATTCACAAGGTTCAGAGAGGG - Intergenic
1043674011 8:82926326-82926348 CATTTCAGCAACTTCTAATATGG - Intergenic
1044877193 8:96681339-96681361 CATTTCAGCAGCTCCAGCCATGG + Intronic
1046113460 8:109755272-109755294 CAATACAGCAACTTCAGTTTTGG - Intergenic
1046670360 8:117050240-117050262 CACTTGAGCAGGTTCAGAGATGG + Intronic
1047251105 8:123182645-123182667 CAATCCCGCAGCTGCAGATGAGG + Exonic
1049183046 8:141232934-141232956 CACCTCAGCAGCTTGAGATTGGG - Intronic
1050738411 9:8791024-8791046 ATATTCACCAGCTTCAAATATGG - Intronic
1056027649 9:82516018-82516040 CAATTAAGCAACTTCAGTTGGGG - Intergenic
1057025147 9:91729476-91729498 TGATTCAGCAGCTCCAGATTTGG - Intronic
1058276912 9:103054684-103054706 CTATTCAGCATCTTCTTATAAGG - Intergenic
1186867644 X:13736156-13736178 CATTTCAGCAGCTTACGATTGGG - Intronic
1187048143 X:15669312-15669334 CATTTCAGCAATTTCACATATGG + Intergenic
1187054009 X:15724051-15724073 CATTTCAGCAACTTCACATAAGG + Intronic
1189016646 X:37291781-37291803 GAATGCAACATCTTCAGATAGGG + Intergenic
1190070056 X:47272276-47272298 CCATTCAGCTGCTTCTGAAAGGG - Intergenic
1190966383 X:55305377-55305399 AAATGCAGCAGCTTCAGTCAAGG - Intergenic
1192043339 X:67645802-67645824 CAATCCAACAGCTTCACAGATGG - Intronic
1195070820 X:101277568-101277590 CAAAGCAGGAGTTTCAGATAGGG - Intronic
1195653541 X:107312581-107312603 CCAATCAGCAGCTTCAAAAATGG + Intergenic
1199894580 X:152118014-152118036 CAAGTCAGCAGCATCACATCCGG + Intergenic
1201692928 Y:16789321-16789343 CAATGCAGCAGCCTCAGTCAGGG + Intergenic
1201738181 Y:17293626-17293648 CAATTCCACAGCATCAGATGAGG + Intergenic
1201867997 Y:18675050-18675072 CATTTCAGCAGCTTACGATTGGG - Intergenic