ID: 1064731287

View in Genome Browser
Species Human (GRCh38)
Location 10:18333313-18333335
Sequence AGAGGGATAAACTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064731279_1064731287 25 Left 1064731279 10:18333265-18333287 CCTTATCTGAAGCTGCTGAATTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1064731287 10:18333313-18333335 AGAGGGATAAACTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064731287 Original CRISPR AGAGGGATAAACTCTGAGGA AGG Intronic
No off target data available for this crispr