ID: 1064735483

View in Genome Browser
Species Human (GRCh38)
Location 10:18377999-18378021
Sequence CTTCATGTTAATTAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064735479_1064735483 18 Left 1064735479 10:18377958-18377980 CCCTTGAACTCTTTCTTTTGGCT No data
Right 1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG No data
1064735480_1064735483 17 Left 1064735480 10:18377959-18377981 CCTTGAACTCTTTCTTTTGGCTG 0: 1
1: 0
2: 1
3: 42
4: 712
Right 1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064735483 Original CRISPR CTTCATGTTAATTAGGAGCC AGG Intronic
No off target data available for this crispr