ID: 1064735733

View in Genome Browser
Species Human (GRCh38)
Location 10:18379975-18379997
Sequence GTAGAATAGTGGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 10, 3: 88, 4: 777}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064735733_1064735740 9 Left 1064735733 10:18379975-18379997 CCACACCTGGCCCACTATTCTAC 0: 1
1: 0
2: 10
3: 88
4: 777
Right 1064735740 10:18380007-18380029 CTATGAATTTGACTACACTGGGG No data
1064735733_1064735739 8 Left 1064735733 10:18379975-18379997 CCACACCTGGCCCACTATTCTAC 0: 1
1: 0
2: 10
3: 88
4: 777
Right 1064735739 10:18380006-18380028 TCTATGAATTTGACTACACTGGG 0: 7
1: 201
2: 629
3: 1092
4: 1375
1064735733_1064735738 7 Left 1064735733 10:18379975-18379997 CCACACCTGGCCCACTATTCTAC 0: 1
1: 0
2: 10
3: 88
4: 777
Right 1064735738 10:18380005-18380027 TTCTATGAATTTGACTACACTGG No data
1064735733_1064735741 24 Left 1064735733 10:18379975-18379997 CCACACCTGGCCCACTATTCTAC 0: 1
1: 0
2: 10
3: 88
4: 777
Right 1064735741 10:18380022-18380044 CACTGGGGATTTCATATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064735733 Original CRISPR GTAGAATAGTGGGCCAGGTG TGG (reversed) Intronic
901479881 1:9517952-9517974 ATATAAAAGTTGGCCAGGTGTGG + Intergenic
901482768 1:9537361-9537383 TTAAAATAATAGGCCAGGTGCGG + Intergenic
901559259 1:10057100-10057122 GAATAATAAGGGGCCAGGTGTGG - Intronic
901610390 1:10493581-10493603 ATATAAAAATGGGCCAGGTGTGG - Intronic
901866034 1:12107237-12107259 ATACAAAAGTTGGCCAGGTGTGG + Intronic
902036396 1:13461297-13461319 GTACATAAGTGGGCCAGATGGGG + Intergenic
902118803 1:14144006-14144028 GAAAACTAGTTGGCCAGGTGCGG - Intergenic
902213324 1:14919330-14919352 ATACAAAAGTGAGCCAGGTGTGG - Intronic
903360428 1:22773576-22773598 CTAGAATTGGGGGCCAGCTGGGG - Intronic
903698833 1:25231094-25231116 GTAAGATACTGGGCCGGGTGCGG - Intronic
903921312 1:26803323-26803345 ATAGAAAAGGGGGCAAGGTGGGG - Intergenic
904122202 1:28207085-28207107 GAAAAAAATTGGGCCAGGTGCGG + Intronic
904203977 1:28840629-28840651 GTAAAATACGGGGCCAGGCGTGG + Intronic
904680445 1:32225450-32225472 TTAAAATACTTGGCCAGGTGTGG + Intronic
904726663 1:32553907-32553929 GTAGAATTTTGGGCCGGGTACGG + Intronic
904765178 1:32840329-32840351 AGAAAATAGGGGGCCAGGTGCGG - Intronic
905163330 1:36057028-36057050 AAAGAATAGTAGGCCGGGTGCGG - Exonic
905171227 1:36111008-36111030 GGAGAGTAGTGGGGCAGGTGGGG - Intronic
905187284 1:36205560-36205582 ATAGTAAACTGGGCCAGGTGTGG + Intergenic
905209941 1:36367136-36367158 GTAGAAGAGTTGGCCAGGTGTGG - Intronic
905836268 1:41124748-41124770 ATAGAAAAATTGGCCAGGTGTGG - Intronic
906162681 1:43662188-43662210 CTATGACAGTGGGCCAGGTGTGG - Intronic
906181687 1:43825973-43825995 AAAGAATAATGGGCCGGGTGAGG + Intronic
906193888 1:43916867-43916889 TAAGAATTTTGGGCCAGGTGCGG - Intronic
906358308 1:45128487-45128509 TTAAAATAGTGGGCCAGGGGCGG - Intronic
906365692 1:45207239-45207261 GTAGAAGACTGAGCCAAGTGAGG - Intronic
906768176 1:48455668-48455690 TTAAAGTAGTAGGCCAGGTGCGG - Intronic
907085426 1:51668329-51668351 TAAGAAAAGGGGGCCAGGTGTGG + Intronic
907090926 1:51724572-51724594 CAAGAAGAGTGGGCCAGGCGTGG - Intronic
907148029 1:52254674-52254696 ATTGGATAATGGGCCAGGTGTGG + Intronic
907347888 1:53798843-53798865 GTCATATAATGGGCCAGGTGTGG - Intronic
910631770 1:89362840-89362862 GTAAAATTCTGGGCCAGGTGCGG - Intergenic
911531489 1:99048429-99048451 GAAGCATAGATGGCCAGGTGTGG - Intergenic
912349298 1:108996825-108996847 TTAGACTCATGGGCCAGGTGCGG + Intronic
912922976 1:113887051-113887073 GTAGAAAAATTAGCCAGGTGTGG - Intronic
913089683 1:115468055-115468077 GAAGAAAATTGGGCCAGGGGTGG + Intergenic
913230795 1:116739507-116739529 CTGGAAGAGTGGTCCAGGTGGGG - Intergenic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
914891115 1:151624254-151624276 TTAGAATTTTAGGCCAGGTGAGG - Intronic
914959713 1:152195916-152195938 ATAGAAAAGTGGGAAAGGTGGGG - Intergenic
915060028 1:153173849-153173871 GTGGAAGAGTGGCCTAGGTGGGG - Intergenic
915139614 1:153759127-153759149 ATAGAAAAATGAGCCAGGTGAGG + Intronic
915397082 1:155593202-155593224 TAAGAACAGTAGGCCAGGTGCGG - Intergenic
915404543 1:155649539-155649561 ATAGTATATAGGGCCAGGTGCGG - Intergenic
915696181 1:157744809-157744831 GAACAATAGGGGGCAAGGTGGGG + Intergenic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
916336691 1:163679078-163679100 GCAGAATAGAGGGTTAGGTGGGG + Intergenic
916716373 1:167450203-167450225 CTTGAAAAATGGGCCAGGTGCGG + Intronic
917304376 1:173612086-173612108 GTAGAAAAATTAGCCAGGTGTGG + Intronic
917880870 1:179334723-179334745 TTACAATACTGGGCCAGGTGCGG + Intronic
918327621 1:183425425-183425447 ATTTAAAAGTGGGCCAGGTGCGG - Intergenic
918570303 1:185982729-185982751 TTAGGAATGTGGGCCAGGTGTGG - Intronic
918729609 1:187974553-187974575 TTAGAAAAGTAGGCCGGGTGCGG - Intergenic
918853518 1:189721809-189721831 GTAGCCTACTAGGCCAGGTGTGG - Intergenic
919100429 1:193090092-193090114 GATGAAAAGTTGGCCAGGTGCGG - Intronic
919331341 1:196176156-196176178 GTAAATGAGTAGGCCAGGTGAGG + Intergenic
919913710 1:202127604-202127626 TTATAATAATGGGCCGGGTGCGG - Intronic
920221201 1:204402710-204402732 TTACAAAAGTGGGCCAGGTATGG - Intergenic
920454675 1:206090495-206090517 GAGGAATTGTGGGCCAGGCGCGG - Intronic
920794710 1:209127974-209127996 GTATAATAATTAGCCAGGTGTGG + Intergenic
921215740 1:212935355-212935377 TTATAATAATTGGCCAGGTGTGG - Intergenic
921604462 1:217137894-217137916 GTGGAATAGGGTGCAAGGTGAGG - Intergenic
922977073 1:229794035-229794057 GTATAAAAGTCAGCCAGGTGTGG + Intergenic
923655639 1:235913798-235913820 GTAGCAAATTGGGCCAGGTGTGG + Intergenic
923868908 1:237969841-237969863 GGAGAATATAAGGCCAGGTGTGG + Intergenic
924086571 1:240457840-240457862 GTAGCCTAGTGGGCCAAGTGAGG + Intronic
924174404 1:241375174-241375196 GTACAAAAGTTAGCCAGGTGTGG + Intergenic
924176482 1:241396531-241396553 GTAGGATAGTGAGCCATGTCAGG + Intergenic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924333420 1:242963604-242963626 ATACAAAAGTTGGCCAGGTGTGG - Intergenic
924541461 1:244984677-244984699 GTATAAAAATGAGCCAGGTGTGG + Intronic
924664702 1:246059164-246059186 GTGGAGTTGTGGGCCGGGTGCGG - Intronic
924755595 1:246937853-246937875 GTTGAAGGGTGGGCCAGGCGTGG - Intergenic
1062948300 10:1477035-1477057 GTTGGATCGTAGGCCAGGTGGGG - Intronic
1063301624 10:4854380-4854402 GTAAAGGAGTAGGCCAGGTGCGG - Intergenic
1063579062 10:7288878-7288900 ATAGAAAAATGAGCCAGGTGTGG + Intronic
1063809861 10:9692539-9692561 TTAGAAGTCTGGGCCAGGTGCGG - Intergenic
1063899644 10:10719246-10719268 GTATAATAATAGGCCGGGTGCGG - Intergenic
1064465934 10:15581946-15581968 GTGTAAAAGTGGGCCAGGTACGG + Intronic
1064735733 10:18379975-18379997 GTAGAATAGTGGGCCAGGTGTGG - Intronic
1064773404 10:18749042-18749064 AAAGAATTTTGGGCCAGGTGTGG - Intergenic
1065367408 10:24950022-24950044 AGAGAGTAGAGGGCCAGGTGAGG - Intronic
1065840612 10:29697368-29697390 ATAGAAAAGGGGGCAAGGTGGGG + Intronic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1065923747 10:30417296-30417318 CAGGAATAGTGGGCCAGGCGCGG - Intergenic
1065968953 10:30790865-30790887 GAAAAAAAGTGGGCCAGGAGTGG - Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1066973433 10:42340939-42340961 ATAGAAAAGAGGGCCAGGTACGG + Intergenic
1068474209 10:57505231-57505253 GTAGAATTGTGGGCTGGGGGTGG - Intergenic
1069473113 10:68710627-68710649 GAAGAAGAAAGGGCCAGGTGCGG - Intergenic
1070206887 10:74273100-74273122 GAAGAATTGTGGCCCAGTTGTGG + Intronic
1070281581 10:75052740-75052762 GAAGAATAGTTGGCCAGGCGTGG - Intronic
1070316379 10:75317230-75317252 GTGGGATGTTGGGCCAGGTGTGG - Intergenic
1070489728 10:76965300-76965322 GTAGAATAGTAGACCAGGACTGG - Intronic
1070556763 10:77533972-77533994 GCAGCATAGTGGGCCAGCTTTGG - Intronic
1071521499 10:86334095-86334117 GGGGACTAGGGGGCCAGGTGTGG - Intronic
1072179734 10:92969982-92970004 ATACAATAGTCGACCAGGTGCGG - Intronic
1072506082 10:96068876-96068898 TTTGAAAAATGGGCCAGGTGTGG + Intergenic
1072589759 10:96818681-96818703 GTAAAATAGTTGGCCAGGCGTGG - Intergenic
1073000157 10:100278384-100278406 ATAGAAAAGGGGGCAAGGTGGGG + Intronic
1073154481 10:101335631-101335653 AAAGAATTTTGGGCCAGGTGTGG + Intergenic
1073323488 10:102629504-102629526 GCAGAAGAGTGGGACAAGTGTGG - Intronic
1073372715 10:103005356-103005378 GAAGTACAGTTGGCCAGGTGCGG + Intronic
1073485485 10:103815598-103815620 GAAAAATACTGGGCCAGGTGCGG + Intronic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1074234547 10:111572297-111572319 GTACAAAAATGAGCCAGGTGTGG - Intergenic
1074460954 10:113636294-113636316 GTACAAGAGTGGCCAAGGTGTGG - Intronic
1075315070 10:121446747-121446769 AAAGAATAGTGGGCCGGGTGTGG + Intergenic
1075437024 10:122452173-122452195 TTAAAATAGTTGGCCAGGTGCGG - Intergenic
1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG + Intronic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1076113816 10:127881489-127881511 CCAGAGTAGAGGGCCAGGTGTGG - Intronic
1078218955 11:9335530-9335552 ATAGAAAAGTTGGCCAGATGTGG + Intergenic
1078259920 11:9695948-9695970 ATACAAAAGTGAGCCAGGTGTGG - Intronic
1078427533 11:11264115-11264137 GTATATTACTGGGCCAGGTTTGG + Intergenic
1078827137 11:14940133-14940155 ACAGAAAATTGGGCCAGGTGTGG - Intronic
1080243774 11:30156667-30156689 TTAGAAATCTGGGCCAGGTGCGG - Intergenic
1080754819 11:35186980-35187002 ATAGAATATTAGGCCAGGTGTGG + Intronic
1080852512 11:36082216-36082238 TTAAAAAAGTTGGCCAGGTGTGG + Intronic
1081985969 11:47304518-47304540 ATACAATAGAGGGCCAGGCGTGG - Intronic
1082231066 11:49767200-49767222 TTAGAACAGTGGGCCAGGTGTGG + Intergenic
1082937313 11:58668411-58668433 GAATAATATTGGGCCAGGTGCGG + Intronic
1083484720 11:62976202-62976224 GGACAATAGCTGGCCAGGTGTGG - Intronic
1083552555 11:63600892-63600914 GTAGAAGAGTAGGCCGGGCGTGG - Intronic
1083706836 11:64522555-64522577 GTGGAATAGTAGGCCAGGAGGGG - Intergenic
1083865810 11:65452023-65452045 ATAGAAAAGGGGGCAAGGTGGGG + Intergenic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1084134350 11:67164886-67164908 GTACAATAGCAGGCCAGGCGCGG - Intronic
1084268710 11:68017951-68017973 GAAGCAGAGTGGGCAAGGTGAGG - Intronic
1084500560 11:69532701-69532723 TTACAATAGAAGGCCAGGTGTGG + Intergenic
1085116380 11:73936029-73936051 ATAGAAAAGGGGGCAAGGTGGGG - Intergenic
1085373440 11:76034488-76034510 ATAAAATAATGGGCCAGGTGCGG - Intronic
1085738287 11:79058251-79058273 GAAGGATAATGGGCCAGGTGCGG + Intronic
1086098584 11:83074631-83074653 ATAGAAAAGTTAGCCAGGTGTGG + Intergenic
1086509869 11:87544579-87544601 GAAGGATAGTGGGGGAGGTGTGG - Intergenic
1086618982 11:88861771-88861793 TTAGAACTGTGGGCCAGGTGTGG - Intronic
1087015724 11:93552760-93552782 GTAATAATGTGGGCCAGGTGCGG - Intergenic
1087118766 11:94551116-94551138 AAAGAATAGAAGGCCAGGTGCGG + Intronic
1087274655 11:96149121-96149143 ATTGAAAAGTAGGCCAGGTGTGG + Intronic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088159336 11:106850518-106850540 GTAGAATTGTGGGTGAGGTTGGG - Intronic
1088166944 11:106950442-106950464 CCAGAATAAGGGGCCAGGTGTGG - Intronic
1088254754 11:107892791-107892813 ATTGAATTCTGGGCCAGGTGCGG + Intronic
1088509390 11:110559138-110559160 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1088591448 11:111407378-111407400 ATAGCATAATGGGCCGGGTGCGG + Intronic
1088606142 11:111534796-111534818 CTAAAGAAGTGGGCCAGGTGTGG - Intronic
1088635690 11:111818067-111818089 ATAGAAGTGAGGGCCAGGTGTGG - Intronic
1089167368 11:116487497-116487519 GAAGAATTTGGGGCCAGGTGTGG + Intergenic
1089876085 11:121723247-121723269 GGAGAGTAGGGGGCCGGGTGGGG - Intergenic
1090293462 11:125566610-125566632 GAAGGATGGCGGGCCAGGTGCGG + Intergenic
1090481083 11:127069180-127069202 TTGGAATAGTCGGCCAGGCGTGG + Intergenic
1090832752 11:130430467-130430489 GTACAAAAGTTAGCCAGGTGTGG - Intergenic
1090843717 11:130514085-130514107 GCAAAATATTGGGCCATGTGCGG - Intergenic
1091610763 12:2006117-2006139 TTTTAAGAGTGGGCCAGGTGCGG + Intronic
1091748505 12:3008320-3008342 GGACCATAGTGGGGCAGGTGTGG + Intronic
1092516583 12:9221101-9221123 TTACCATAGTTGGCCAGGTGCGG + Intergenic
1093054646 12:14543817-14543839 GTATAATAGTAGGGAAGGTGTGG - Intronic
1093294700 12:17374487-17374509 ATAGAGAAGTGGGCCAGGCGCGG - Intergenic
1093453839 12:19344964-19344986 GTACAAAAATTGGCCAGGTGTGG + Intronic
1093621991 12:21302710-21302732 GTACAAAAATTGGCCAGGTGTGG - Intronic
1093747678 12:22761759-22761781 GTAGAATTTTGGGCCAGGAATGG + Intergenic
1093775446 12:23068434-23068456 TTACAATCTTGGGCCAGGTGCGG - Intergenic
1094074829 12:26460921-26460943 GTAGAATAGAGGGAGAAGTGGGG - Intronic
1094216648 12:27949501-27949523 GTAAAATCATGGGCCAGGTATGG + Intergenic
1094705809 12:32913432-32913454 ATACAAAAGTTGGCCAGGTGTGG - Intergenic
1095242491 12:39877978-39878000 GTAGGAGAGTGGGTCAGGGGAGG - Intronic
1095739327 12:45590076-45590098 ATAAAATATTAGGCCAGGTGTGG + Intergenic
1095885391 12:47183738-47183760 TTAGAATTGTGTGCCACGTGAGG + Intronic
1095925157 12:47570866-47570888 GTACAAAAGTTGGCCAGGAGAGG + Intergenic
1096084090 12:48853673-48853695 TTAAAAGAATGGGCCAGGTGAGG + Intergenic
1096227480 12:49875683-49875705 TTTAAAAAGTGGGCCAGGTGCGG + Intronic
1096287205 12:50310696-50310718 GTATAATAGTTGGCCAGGTGTGG + Intergenic
1096288266 12:50318973-50318995 GGGGAATAATAGGCCAGGTGTGG - Intergenic
1096358022 12:50958859-50958881 ATACAAAAGTTGGCCAGGTGTGG + Intronic
1096382130 12:51167903-51167925 GTAGAAAAACTGGCCAGGTGTGG + Intronic
1096598010 12:52709483-52709505 GAAGAAGAGTGGGCCAAGGGTGG - Intergenic
1097056137 12:56250591-56250613 GAAAAATTGTGGGCTAGGTGTGG + Intronic
1097126782 12:56783084-56783106 ATAGAAAAGGGGGCAAGGTGGGG - Intronic
1097790847 12:63813960-63813982 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1097832596 12:64241277-64241299 ATAGAAAAATGGGCCGGGTGTGG + Intergenic
1098338326 12:69425951-69425973 ATACAATATTAGGCCAGGTGTGG + Intergenic
1098582373 12:72115226-72115248 GTAGAATAGTGGGAGGGGGGTGG - Intronic
1098791512 12:74830046-74830068 CTAGCAAAGTGGGCCGGGTGAGG - Intergenic
1098886123 12:75962436-75962458 CTACAAAAGTGAGCCAGGTGTGG - Intergenic
1099446193 12:82754579-82754601 GTACAAAAATTGGCCAGGTGTGG + Intronic
1099976964 12:89556282-89556304 GTATAGAACTGGGCCAGGTGTGG + Intergenic
1100349790 12:93769372-93769394 ATAGAATGGTGGGCCAAGAGTGG - Intronic
1100977495 12:100137607-100137629 GTAGAAAATGGGGCCAGGTGTGG - Intronic
1101747754 12:107556718-107556740 GTGGAATAGTGGGCCGGGCATGG + Intronic
1101770303 12:107743822-107743844 CTAGAAAAATAGGCCAGGTGCGG + Intronic
1102085203 12:110131636-110131658 GTAGTTGAATGGGCCAGGTGAGG - Intronic
1102192664 12:111000627-111000649 GTAAAGTTGTAGGCCAGGTGTGG - Intergenic
1102445621 12:113000033-113000055 CTATAACAATGGGCCAGGTGAGG - Intronic
1102450358 12:113037403-113037425 GAAGAGTTATGGGCCAGGTGCGG - Intergenic
1102623706 12:114217450-114217472 TTAAAATTATGGGCCAGGTGTGG + Intergenic
1102695461 12:114795676-114795698 GTATAATAATGGGCCAGGCATGG - Intergenic
1103219687 12:119233294-119233316 TTACAAAATTGGGCCAGGTGCGG + Intergenic
1103494241 12:121349268-121349290 ATACAGTAGGGGGCCAGGTGTGG + Intronic
1103541233 12:121668021-121668043 ATACAAAAATGGGCCAGGTGGGG - Intronic
1103729380 12:123016753-123016775 ATAGTTTAGTAGGCCAGGTGCGG + Intronic
1105257397 13:18753200-18753222 GTAGAATGGTGGGAGAGTTGGGG - Intergenic
1105257409 13:18753250-18753272 GTAGAATGGTGGGAGAGTTGGGG - Intergenic
1105332182 13:19428156-19428178 TTAGAAAAATGGGCCAGGTGCGG + Intronic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1105498954 13:20954679-20954701 AGAGAAAAATGGGCCAGGTGTGG + Intergenic
1105718433 13:23090605-23090627 GTAAAATATTCGGCCAGGTGGGG - Intergenic
1106275187 13:28197856-28197878 GTAAAATATTCGGCCAGGAGAGG - Intronic
1106369886 13:29121948-29121970 GTGAAAAAGTGGGCCGGGTGTGG - Intronic
1106427800 13:29649480-29649502 ATAAAATATTTGGCCAGGTGTGG + Intergenic
1106562646 13:30859945-30859967 TTAGATTAGTGGGCAGGGTGCGG + Intergenic
1106685798 13:32057460-32057482 GTAGCCTACTAGGCCAGGTGTGG - Intronic
1106715386 13:32383069-32383091 GAAGAAAAGGGGGCCAGGCGCGG + Intronic
1106729492 13:32524916-32524938 GTAGAAAAATTAGCCAGGTGTGG - Intronic
1107142427 13:37015993-37016015 GTAGAATAGTGGCCGAGGGGAGG + Intronic
1107498208 13:40949274-40949296 TTAAAGTATTGGGCCAGGTGCGG - Intronic
1107649898 13:42534762-42534784 GTAGAATAGTGAGGGAGGAGTGG - Intergenic
1108051051 13:46439541-46439563 CTATAGTAGTGGGCCAGGAGAGG - Intergenic
1108366968 13:49725795-49725817 GTACAAAAATGAGCCAGGTGTGG - Intronic
1108420102 13:50240065-50240087 AAAAAATAGTGGGCCGGGTGCGG - Intronic
1108697298 13:52913716-52913738 GTGGAGTAGTGGGAGAGGTGAGG + Intergenic
1109302671 13:60605270-60605292 GTAGGAAAGTGGGCCAGGCATGG + Intergenic
1109305681 13:60638217-60638239 GTAGAGTTTTCGGCCAGGTGCGG + Intergenic
1110739307 13:78976068-78976090 GGAGAATTTGGGGCCAGGTGCGG - Intergenic
1110804563 13:79739086-79739108 GTAGGAAAGTGGGCCAGGCATGG - Intergenic
1111288508 13:86128562-86128584 TAAGAATATAGGGCCAGGTGGGG - Intergenic
1111398162 13:87695561-87695583 ATAAAAAAGGGGGCCAGGTGTGG - Exonic
1111507697 13:89215806-89215828 GTGAAATTGTTGGCCAGGTGAGG + Intergenic
1111765829 13:92527460-92527482 GTAAAATAGGGGGTAAGGTGTGG + Intronic
1112051378 13:95646707-95646729 AAAGAATAATAGGCCAGGTGAGG + Intergenic
1112470372 13:99683026-99683048 GTAAAAAGTTGGGCCAGGTGTGG - Intronic
1112742026 13:102486047-102486069 ATACAAAAGTTGGCCAGGTGTGG + Intergenic
1113458180 13:110463824-110463846 GTAAAAATGTGGGCCGGGTGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114223869 14:20721306-20721328 GTACAACATTGAGCCAGGTGCGG - Intergenic
1114645472 14:24253770-24253792 GTACATTAGAAGGCCAGGTGTGG - Intronic
1114899137 14:27034092-27034114 GTAGAAGAGTCGGCCGGGCGCGG - Intergenic
1115205303 14:30897292-30897314 GTAATATAGTAGGCCAGCTGTGG + Intronic
1115220989 14:31058218-31058240 GTAGAATACGGGGCCAGGCGAGG - Intronic
1115277644 14:31625629-31625651 ATACAAAAGTGAGCCAGGTGTGG - Intronic
1115277741 14:31626428-31626450 GCTAAACAGTGGGCCAGGTGCGG - Intronic
1115590367 14:34858603-34858625 TTTAAATTGTGGGCCAGGTGTGG - Intronic
1116794584 14:49376052-49376074 GTAAAATAGTTGGCCGGGTGCGG + Intergenic
1116810836 14:49538571-49538593 GCAGAATGCTGGGCCAGGTGTGG + Intergenic
1116834749 14:49759226-49759248 TTAAAATTGTTGGCCAGGTGCGG + Intergenic
1116841365 14:49821861-49821883 ATAGAAAAGGGGGCAAGGTGGGG + Intronic
1117172257 14:53113113-53113135 ATAGAAAAGTTAGCCAGGTGTGG - Intronic
1117824557 14:59688068-59688090 CTAGAATAGTGGGGCAGCTCAGG - Intronic
1118212528 14:63778803-63778825 AAATAATAATGGGCCAGGTGCGG - Intergenic
1118648530 14:67865390-67865412 ATAGAATAATTAGCCAGGTGTGG - Intronic
1119397262 14:74336116-74336138 GTAAAAAAGCTGGCCAGGTGCGG + Intronic
1119719075 14:76879078-76879100 ATACAAAAATGGGCCAGGTGTGG + Intergenic
1119749197 14:77065478-77065500 GAAGAAAAGTGAGCCAGGCGCGG + Intergenic
1119828686 14:77680964-77680986 AAAGAGTAGTGGGCCAGTTGTGG - Intronic
1120110662 14:80551720-80551742 GTAGAGTAGTGGAAGAGGTGAGG + Intronic
1120158732 14:81122566-81122588 GTAGAAGAGTGTGTCAGGAGAGG + Intronic
1120537882 14:85719371-85719393 GTTGACAAGTTGGCCAGGTGTGG - Intergenic
1120678953 14:87456118-87456140 CTAAAATATTTGGCCAGGTGTGG - Intergenic
1120748460 14:88175005-88175027 GCAGAATAGTGGGCCTGCTGTGG - Intergenic
1122707691 14:103631368-103631390 GTATAAATTTGGGCCAGGTGCGG - Intronic
1122734528 14:103829764-103829786 GTAAAATATTTAGCCAGGTGTGG - Intronic
1123075530 14:105665748-105665770 GTGGGACAGTGGGACAGGTGGGG + Intergenic
1123914288 15:25006344-25006366 ATAGAGGTGTGGGCCAGGTGTGG - Intergenic
1124138477 15:27056193-27056215 GCAAAATAATGAGCCAGGTGTGG + Intronic
1124343005 15:28901969-28901991 GAAGAATAAAGGGCCAGATGGGG + Intronic
1124352240 15:28964776-28964798 GAGCAAAAGTGGGCCAGGTGCGG - Intronic
1124454032 15:29823795-29823817 TAAGAATTGTGGGCCAGGCGTGG + Intronic
1124720209 15:32105228-32105250 GTATTAAACTGGGCCAGGTGAGG + Intronic
1124732191 15:32208530-32208552 GTATAATTGAAGGCCAGGTGTGG + Intergenic
1125012933 15:34899659-34899681 ATATAATAATAGGCCAGGTGTGG - Intronic
1126120043 15:45243269-45243291 ATAGAACTCTGGGCCAGGTGTGG + Intergenic
1126188516 15:45854419-45854441 GTTGGAGAGTGGGCCAGGTGTGG - Intergenic
1126648851 15:50901767-50901789 TTAGTTGAGTGGGCCAGGTGCGG - Intergenic
1126814421 15:52440556-52440578 GATGACTGGTGGGCCAGGTGCGG - Intronic
1126943589 15:53792538-53792560 AAACAATAGTGGGCCAGGCGTGG + Intergenic
1127069900 15:55278770-55278792 TTAGAAGACTGGGCCAGGTGCGG - Intronic
1127077811 15:55345178-55345200 TTAGAATATGGGGCCAGCTGTGG - Intronic
1127115700 15:55724601-55724623 GTACAAAAGTTAGCCAGGTGTGG + Intronic
1127610825 15:60634691-60634713 GTAAAAAAGTGGGCCAGGTGCGG - Intronic
1127627624 15:60795748-60795770 GGAGAATGGTGGGCTAGGTGAGG - Intronic
1127813138 15:62581751-62581773 AGTGAATAGTGGGCCGGGTGCGG + Intronic
1127851715 15:62919070-62919092 GTAGTCTTTTGGGCCAGGTGCGG - Intergenic
1127877714 15:63125028-63125050 GAAGAAAAATGGGCCAGTTGAGG + Intronic
1127919534 15:63482319-63482341 GTAGGATAGTTGGCCAGGTGCGG - Intergenic
1128048770 15:64643803-64643825 GTAACAAAGTAGGCCAGGTGTGG + Intronic
1128160408 15:65420100-65420122 ATACAAAAGTTGGCCAGGTGTGG - Intronic
1128492702 15:68165409-68165431 GTAAAATTTTTGGCCAGGTGCGG - Intronic
1128498896 15:68213656-68213678 GTAGAAAACTCGGCCAGGCGCGG - Intronic
1128569204 15:68721170-68721192 AGTGATTAGTGGGCCAGGTGTGG - Intronic
1129084249 15:73071804-73071826 AAACAAAAGTGGGCCAGGTGTGG - Intronic
1129283326 15:74503297-74503319 GTAGAATGGTAGGCCAGGCGTGG - Intergenic
1129414155 15:75365792-75365814 CATGAATACTGGGCCAGGTGCGG + Intronic
1129534034 15:76296235-76296257 GAATATTAGTAGGCCAGGTGCGG - Intronic
1129553650 15:76481019-76481041 GTAGAATAGTGGGCCGGGCGCGG - Intronic
1129834588 15:78694085-78694107 GCAGAATATTCAGCCAGGTGTGG - Intronic
1129979734 15:79857287-79857309 TAAGAATAGTGGGCCAGGCACGG - Intronic
1130350800 15:83090102-83090124 TTAGGAGATTGGGCCAGGTGTGG + Intergenic
1130673833 15:85935360-85935382 GTAGAATTGGGAGCCAGGTTGGG - Intergenic
1132021445 15:98366011-98366033 GGATACTAGTCGGCCAGGTGCGG - Intergenic
1132353078 15:101152482-101152504 GTAGTAGTGTAGGCCAGGTGCGG - Intergenic
1132922332 16:2403936-2403958 TAAGAATAATGGGCCAGGCGTGG - Intergenic
1133937759 16:10283062-10283084 GGAGAAAAGGTGGCCAGGTGTGG - Intergenic
1134222455 16:12365750-12365772 GCAGAACAGTGGGCCGGGCGCGG + Intronic
1134273611 16:12756402-12756424 TAAGAACAGTGAGCCAGGTGCGG + Intronic
1134277427 16:12789223-12789245 GTGGTAAATTGGGCCAGGTGGGG - Intronic
1135105030 16:19641917-19641939 AAAGAATTCTGGGCCAGGTGCGG + Intronic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1135793606 16:25421189-25421211 ACAGAAAAATGGGCCAGGTGTGG - Intergenic
1136373487 16:29850454-29850476 ATACAAAAGTGAGCCAGGTGTGG + Intergenic
1136857830 16:33675060-33675082 AAAAAAAAGTGGGCCAGGTGTGG - Intergenic
1137033336 16:35544961-35544983 GTAGAAGAATAGGCCAGTTGCGG + Intergenic
1137492970 16:48948506-48948528 CTAGAGGAGTTGGCCAGGTGCGG + Intergenic
1137935275 16:52629149-52629171 GTGGAGAAGTGGGTCAGGTGGGG - Intergenic
1137975828 16:53031002-53031024 GTATAATTATTGGCCAGGTGAGG - Intergenic
1138001286 16:53282448-53282470 GTAGAAAAATTGGCTAGGTGCGG + Intronic
1138021253 16:53483598-53483620 ATGTAATAATGGGCCAGGTGTGG + Intronic
1138557517 16:57781160-57781182 ATACAAAAGTGGGCCAGGTGTGG + Intronic
1138761158 16:59546227-59546249 GTACAATAATTAGCCAGGTGTGG + Intergenic
1139023514 16:62782662-62782684 GAAAAATAGTGGGCCAGGGGTGG + Intergenic
1139293283 16:65877011-65877033 GTGGAATAGGTGGTCAGGTGTGG + Intergenic
1139704422 16:68731202-68731224 ATAGAATAATTAGCCAGGTGTGG + Intergenic
1139759659 16:69174423-69174445 ATAGAAAAGTAGGCCAAGTGTGG + Intronic
1139800071 16:69515297-69515319 GTACAACTCTGGGCCAGGTGTGG - Intergenic
1139913781 16:70415605-70415627 ATAGAAAAGTTAGCCAGGTGTGG - Intronic
1141606685 16:85158115-85158137 GGAGACTAGAGGGCCAGGGGAGG - Intergenic
1142206982 16:88788114-88788136 ATACAAAAGTTGGCCAGGTGTGG - Intergenic
1203119411 16_KI270728v1_random:1523538-1523560 AAAAAAAAGTGGGCCAGGTGTGG - Intergenic
1203143881 16_KI270728v1_random:1786828-1786850 GTAGAAAAGGCGGCCAGGTGTGG + Intergenic
1143182770 17:4994060-4994082 ATAAAACAGTGGGCCAGGTGTGG - Intronic
1143237169 17:5412804-5412826 GTAGGGGAGTGGGACAGGTGAGG - Intronic
1143665649 17:8357818-8357840 ATAGAAAATTAGGCCAGGTGTGG - Intergenic
1144205481 17:12976845-12976867 TGAGAGTGGTGGGCCAGGTGAGG + Intronic
1144518298 17:15936172-15936194 GTACAATAACAGGCCAGGTGTGG - Intergenic
1144536596 17:16095878-16095900 ATAGAAAAGGGGGCAAGGTGGGG + Intronic
1144996498 17:19272939-19272961 GTAGAATACATGGGCAGGTGAGG - Intronic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145042360 17:19586306-19586328 GTTAAATTGTGGGCCAGGTGCGG - Intergenic
1145745073 17:27311936-27311958 AGAGAAAAATGGGCCAGGTGTGG - Intronic
1145875537 17:28316402-28316424 ATTTAATAGTGGGCCAGGTGTGG - Intergenic
1146061405 17:29609327-29609349 GAAGCAGAGTGGTCCAGGTGAGG - Intronic
1146303029 17:31706083-31706105 ATACAAAAATGGGCCAGGTGTGG + Intergenic
1146711945 17:35049789-35049811 TTAAAAGAATGGGCCAGGTGTGG + Intronic
1146807927 17:35880130-35880152 GTTGAAAAGAGGGCAAGGTGTGG + Intronic
1146963642 17:37006177-37006199 GAAAAAAAGAGGGCCAGGTGCGG + Intronic
1147019528 17:37520456-37520478 GCAGTAAAGTGGGCCAGATGAGG + Intronic
1147173247 17:38634160-38634182 TTAGAATGGTCGGCCAGGCGTGG + Intergenic
1147379491 17:40045291-40045313 ATAAAAAAATGGGCCAGGTGTGG + Intronic
1147815124 17:43204226-43204248 GTGGCAGAGTTGGCCAGGTGCGG - Intronic
1148524622 17:48319552-48319574 TTAAAATTCTGGGCCAGGTGTGG + Intronic
1149587030 17:57797445-57797467 ATAGAATTTTGGGCCAGGAGTGG + Intergenic
1149786072 17:59436170-59436192 ATAGAATGGTGGGCCAGGCGCGG - Intergenic
1150458498 17:65327528-65327550 GGAGAAACCTGGGCCAGGTGTGG + Intergenic
1150685428 17:67316795-67316817 TTAGATTATGGGGCCAGGTGCGG - Intergenic
1150757597 17:67929823-67929845 TTAAAATGCTGGGCCAGGTGCGG + Intronic
1150993385 17:70287008-70287030 GTACAAAAGTTAGCCAGGTGTGG + Intergenic
1151741444 17:75985299-75985321 ATACAAAAATGGGCCAGGTGTGG - Intronic
1152059636 17:78061524-78061546 TGAAAATACTGGGCCAGGTGTGG + Intronic
1152508208 17:80767080-80767102 AAAGAATAAGGGGCCAGGTGCGG + Intronic
1152775423 17:82198573-82198595 GTAGCATGCTGGTCCAGGTGGGG - Intronic
1153127074 18:1807009-1807031 GTAGAATAGTAGGCAAGGTCAGG + Intergenic
1153676927 18:7464096-7464118 GTAGACTAGTGGAAAAGGTGGGG - Intergenic
1154158294 18:11960218-11960240 ATAGAAAAGGGGGCAAGGTGGGG + Intergenic
1155189236 18:23414515-23414537 GTAGAAAAATAAGCCAGGTGTGG + Intronic
1157091147 18:44638604-44638626 GAAGTTAAGTGGGCCAGGTGTGG + Intergenic
1157263668 18:46198009-46198031 TGAAAATTGTGGGCCAGGTGTGG + Intronic
1157266130 18:46224073-46224095 GTAGCATAGTGGTCCAGTTTAGG - Intronic
1157691406 18:49685041-49685063 ATGGAAGAATGGGCCAGGTGCGG - Intergenic
1157765590 18:50294551-50294573 TAAGAAATGTGGGCCAGGTGCGG - Intergenic
1158116818 18:54005185-54005207 GTAGAATAGGGTGCCAGGAAGGG + Intergenic
1158414301 18:57235867-57235889 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1158516424 18:58134289-58134311 TAAGAATATTAGGCCAGGTGCGG - Intronic
1159589572 18:70318778-70318800 ATAGAATAATTAGCCAGGTGTGG + Intronic
1161059023 19:2205258-2205280 GTCAAAATGTGGGCCAGGTGCGG - Intronic
1161526463 19:4759173-4759195 AAAAAATAGTGGACCAGGTGCGG - Intergenic
1161559685 19:4965745-4965767 GTACAAAAATCGGCCAGGTGTGG - Intergenic
1161906161 19:7158208-7158230 GAAGCATAATGGGCCAGGCGCGG + Intronic
1162184023 19:8890773-8890795 GTGGAGTTGTAGGCCAGGTGCGG + Intronic
1162355083 19:10178264-10178286 ATAAAATAAAGGGCCAGGTGAGG + Intronic
1162651827 19:12094330-12094352 TAAGACTGGTGGGCCAGGTGTGG - Intronic
1162682056 19:12352494-12352516 GTGGACTTGTGAGCCAGGTGTGG - Intronic
1162871044 19:13587035-13587057 GAAGAAAAGAGGGCCAGGCGTGG + Intronic
1163122267 19:15225114-15225136 ATACAAAAATGGGCCAGGTGCGG + Intergenic
1163482597 19:17566821-17566843 GTAAAATAGTAGGCCAGGCATGG + Intronic
1163707986 19:18827666-18827688 GAAAAATAGGAGGCCAGGTGCGG - Intergenic
1163766662 19:19166911-19166933 ATAAATAAGTGGGCCAGGTGCGG + Intronic
1163855112 19:19695505-19695527 AAAGAATAGCCGGCCAGGTGCGG - Intergenic
1163945108 19:20529524-20529546 ATAGAAAAGGGGGCAAGGTGGGG - Intergenic
1164109534 19:22142522-22142544 AAAGAAAAGTTGGCCAGGTGTGG - Intergenic
1164186063 19:22871294-22871316 ATAGAAAAGGGGGCAAGGTGGGG - Intergenic
1164211084 19:23097846-23097868 GAGGTATTGTGGGCCAGGTGTGG + Intronic
1164230089 19:23279598-23279620 GAAAAAAAGTAGGCCAGGTGTGG - Intergenic
1164284484 19:23800900-23800922 GTAGAAATCTAGGCCAGGTGAGG - Intronic
1165007034 19:32815703-32815725 GTAGAAGAGTTGGCTGGGTGCGG + Intronic
1165028375 19:32978855-32978877 GTAAAATAGTGGGACGGTTGTGG + Exonic
1165042293 19:33077498-33077520 GTACAAAAATTGGCCAGGTGTGG - Intergenic
1165201767 19:34150566-34150588 TTAGAATTCTAGGCCAGGTGCGG - Intergenic
1165342258 19:35221398-35221420 ATACAAGAGTTGGCCAGGTGTGG - Intergenic
1165431184 19:35774267-35774289 ATAGAATATTAGGCCAGGCGTGG - Intergenic
1165636581 19:37345386-37345408 GTAGAATAGTGGAGCTGGTAGGG + Intronic
1165668252 19:37652825-37652847 AGAAAATTGTGGGCCAGGTGCGG + Intronic
1166190013 19:41170280-41170302 TTAGAAAAATAGGCCAGGTGCGG + Intergenic
1166280757 19:41791459-41791481 GAATACAAGTGGGCCAGGTGCGG - Intergenic
1166421275 19:42639246-42639268 GTAGAAAAGGGGGAAAGGTGGGG - Intronic
1166580012 19:43888226-43888248 AGACAATAATGGGCCAGGTGCGG + Intronic
1166642799 19:44508678-44508700 GAAGAAAACTGGGCCAGGCGCGG - Intronic
1167341245 19:48917784-48917806 GTAAAAAATTGGGCCGGGTGCGG - Intronic
1167390521 19:49191653-49191675 GTACAAAAGTTAGCCAGGTGTGG - Intronic
1167562479 19:50234108-50234130 GTAGGGTAGGAGGCCAGGTGCGG - Intronic
1167733908 19:51279552-51279574 GTAGAAAAATTAGCCAGGTGTGG + Intergenic
1167897988 19:52597549-52597571 TAAGAAGATTGGGCCAGGTGGGG + Intronic
1168032295 19:53690259-53690281 ATACAAAAGTGAGCCAGGTGTGG - Intergenic
1168039976 19:53750584-53750606 ATACAAAAGTGAGCCAGGTGTGG - Intergenic
1168143727 19:54407184-54407206 GTAGAATTGTTGGCCGGGCGTGG + Intergenic
1168180134 19:54656594-54656616 GTAGACTGGTTGGCCAGGTGTGG - Intronic
1168463322 19:56580662-56580684 GAAGTATAGAGGGCCATGTGAGG + Exonic
1168523915 19:57073816-57073838 GAAAAATAAAGGGCCAGGTGAGG + Intergenic
925217107 2:2106460-2106482 GTACAAAAGTTAGCCAGGTGTGG + Intronic
926014471 2:9437246-9437268 ATAGAAAAATGAGCCAGGTGTGG + Intronic
926222225 2:10943711-10943733 GTAGAGCAGTGAGCCAGGAGGGG + Intergenic
926781436 2:16476010-16476032 GTAGAAAATTGGGCCAGGTAGGG + Intergenic
927594435 2:24384382-24384404 ATAGAAAAGTTAGCCAGGTGTGG - Intergenic
927621563 2:24666302-24666324 ATAAAAAAGTAGGCCAGGTGCGG - Intronic
927906161 2:26858862-26858884 GTACAAAATTAGGCCAGGTGTGG - Intronic
927953106 2:27187491-27187513 CTGGGATATTGGGCCAGGTGTGG + Intergenic
928386047 2:30868880-30868902 ATAGAAAAATTGGCCAGGTGTGG + Intergenic
928566420 2:32555678-32555700 TTAGAGTAGCAGGCCAGGTGTGG + Intronic
928699656 2:33885517-33885539 GGCTAATATTGGGCCAGGTGTGG - Intergenic
929278703 2:40054449-40054471 GTATAGAAGTGGGCCAGGAGTGG + Intergenic
929280283 2:40070956-40070978 GTTGAATATTGGGCTGGGTGCGG + Intergenic
930208676 2:48614277-48614299 ATAGAAAAGGGGGCAAGGTGGGG - Intronic
930474487 2:51864002-51864024 AGAAAATAGTAGGCCAGGTGCGG + Intergenic
930759014 2:55011315-55011337 GTAAAATTTTAGGCCAGGTGTGG - Intronic
930764186 2:55067702-55067724 TTACAATATGGGGCCAGGTGTGG - Intronic
930815238 2:55590035-55590057 ATAAATTTGTGGGCCAGGTGTGG + Intronic
931673736 2:64672729-64672751 GTAGAGCAGAGGTCCAGGTGGGG + Intronic
931754429 2:65359772-65359794 GCAAAAAATTGGGCCAGGTGCGG + Intronic
932157614 2:69432857-69432879 GTATACTATTGGGCCAGGGGTGG + Intronic
932482088 2:72049489-72049511 ATAGAAGACTGGGCTAGGTGCGG + Intergenic
932671112 2:73738580-73738602 GAAGAACATTCGGCCAGGTGCGG + Intergenic
932768383 2:74485758-74485780 ATACAAAATTGGGCCAGGTGCGG - Intronic
933094067 2:78156199-78156221 TTAGAACAGTTGGCCAGGCGCGG - Intergenic
933196876 2:79400657-79400679 GTAAAATAGTGTGCCTGATGAGG - Intronic
933235931 2:79864353-79864375 GGTGCATAGTGGGCAAGGTGGGG + Intronic
933867107 2:86530281-86530303 GAAGAGTTCTGGGCCAGGTGCGG - Intronic
935088558 2:99871915-99871937 AGGGAAAAGTGGGCCAGGTGCGG + Intronic
935393216 2:102576736-102576758 ATAGAAAAATTGGCCAGGTGTGG - Intergenic
935484398 2:103635327-103635349 ATAGAATAGGGGGCCGGGCGTGG - Intergenic
936267416 2:111021174-111021196 GTAGAGGAGTGGGCCAGTGGAGG + Intronic
936420077 2:112355059-112355081 GACAAATACTGGGCCAGGTGCGG + Intergenic
937271291 2:120654648-120654670 GTAAAAGAGCGGGCCAGGCGGGG - Intergenic
937542567 2:122976848-122976870 AAAAAAAAGTGGGCCAGGTGTGG + Intergenic
940077229 2:149755789-149755811 ATAAAAGAATGGGCCAGGTGTGG - Intergenic
940278422 2:151963775-151963797 AAAGAATGTTGGGCCAGGTGCGG + Intronic
940327667 2:152442537-152442559 GGACAGAAGTGGGCCAGGTGTGG - Intronic
940634904 2:156287081-156287103 ATAGAAAAATTGGCCAGGTGTGG - Intergenic
940797520 2:158096306-158096328 ATAAAATAGTGGGCCAGGTGTGG + Intronic
941101478 2:161300754-161300776 ATAATATACTGGGCCAGGTGCGG + Intergenic
941951680 2:171162247-171162269 GTACAATTATTGGCCAGGTGCGG + Intronic
942013575 2:171789120-171789142 GTAGGAGACTGGGCCAAGTGTGG + Intronic
942020506 2:171863233-171863255 GAAGAAAAATGGGCCAGGTGCGG + Intronic
942242354 2:173974362-173974384 ATACAAAAGTGAGCCAGGTGTGG + Intergenic
942280275 2:174356060-174356082 AAAGAATGATGGGCCAGGTGTGG - Intronic
942884048 2:180900422-180900444 GTAGCATTCTGGGCCAGGTGCGG - Intergenic
942904350 2:181163169-181163191 CTTGAAAACTGGGCCAGGTGTGG + Intergenic
943727022 2:191262301-191262323 GCATAAAAGTGGGCCAGCTGGGG - Intronic
943773798 2:191742962-191742984 ATAGAAAAGGGGGCAAGGTGGGG + Intergenic
943992446 2:194713932-194713954 GTAGAAGAGGAGACCAGGTGGGG - Intergenic
944267632 2:197746609-197746631 GAAGCAGAGAGGGCCAGGTGCGG + Intronic
944624845 2:201560135-201560157 GTAAAATTGTGGGCCAGGTACGG + Intronic
944779094 2:202999225-202999247 ATAAAATAGGAGGCCAGGTGTGG + Intronic
944832517 2:203547066-203547088 ATAGTATACTTGGCCAGGTGTGG - Intergenic
945090221 2:206171406-206171428 ATAGAAAAGGGGGCAAGGTGGGG - Intergenic
945242081 2:207685613-207685635 AGAGAGTAATGGGCCAGGTGCGG - Intergenic
945420011 2:209623582-209623604 GTAGAATGGTAGGCCAGCTCTGG - Intronic
946242159 2:218362989-218363011 GTAGAAAAGGGAGGCAGGTGGGG + Intronic
946269589 2:218579775-218579797 GCAGAAAACTGGGCCAGGCGTGG - Intronic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
946953884 2:224907395-224907417 TAAGAATAGAGGGCCAGGCGCGG + Intronic
947157518 2:227177443-227177465 TTAGAAAAATAGGCCAGGTGAGG - Intronic
947254151 2:228143249-228143271 ATATAAGACTGGGCCAGGTGCGG + Intronic
947413190 2:229865015-229865037 GCACAATATTGGGCCAGGTGTGG + Intronic
947798169 2:232906733-232906755 ATAGAAAAGGGGGCAAGGTGGGG + Intronic
948098059 2:235352250-235352272 GAAGACTAGGGGGCCAGGCGTGG + Intergenic
948169341 2:235888546-235888568 ATAAAAAAGTGAGCCAGGTGTGG + Intronic
1168777305 20:458602-458624 GTAGAATTGGAGGCCAGGTATGG - Intronic
1168783667 20:518119-518141 AAAGATGAGTGGGCCAGGTGTGG - Intronic
1168811133 20:705354-705376 GGGGCACAGTGGGCCAGGTGTGG - Intergenic
1169167319 20:3435337-3435359 GTAGAAAAGAGGGCCAGGTGAGG - Intergenic
1169454756 20:5742599-5742621 GTAAAATGGTGGGCCAGGCATGG - Intergenic
1169758170 20:9065355-9065377 ATAGAACATTGGGCCAAGTGTGG - Intergenic
1169874737 20:10284539-10284561 ATAGAAGAATGGGCCAGCTGTGG - Intronic
1170146756 20:13183737-13183759 GTAAAATAGTGGACCGGGCGTGG + Intergenic
1170699751 20:18693364-18693386 GAAAAATTGAGGGCCAGGTGCGG + Intronic
1172130917 20:32654550-32654572 GAATAATGGTGGGCCAGGCGTGG + Intergenic
1172251838 20:33485121-33485143 TAAGAATATTAGGCCAGGTGCGG - Intergenic
1172656011 20:36538921-36538943 GTAGAAAACTTAGCCAGGTGTGG + Intergenic
1172803493 20:37594900-37594922 GTGGGATAGTGGGCTAAGTGAGG + Intergenic
1173213239 20:41054306-41054328 GAAGCAAAGTGGGGCAGGTGCGG - Intronic
1173349954 20:42235547-42235569 ATAAAACAGAGGGCCAGGTGCGG - Intronic
1173680999 20:44881767-44881789 ATAGGTTAATGGGCCAGGTGTGG + Intergenic
1174198832 20:48792913-48792935 GTACATTAGTGGGCCAGGCATGG + Intronic
1174230673 20:49043400-49043422 GTAGATTAGTGGGCCGGGTGTGG + Intergenic
1174451002 20:50620334-50620356 TTAGGATCCTGGGCCAGGTGCGG + Intronic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1174784564 20:53420437-53420459 GAAAAAAAGTGGGCCAGGCGCGG + Intronic
1175104818 20:56607368-56607390 AAAGAAGACTGGGCCAGGTGCGG + Intergenic
1175107051 20:56622933-56622955 GTAACACAGTGGGCCGGGTGCGG - Intergenic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1175869139 20:62199353-62199375 GTAGCATTGTTGGCCAGGCGTGG + Intronic
1176296083 21:5074009-5074031 GGAGCATATAGGGCCAGGTGCGG + Intergenic
1176308876 21:5139250-5139272 GTAGAAAAATTAGCCAGGTGTGG - Intronic
1177523663 21:22264789-22264811 GTAAAAAAATTGGCCAGGTGTGG + Intergenic
1177556152 21:22691229-22691251 GTACAAAAATTGGCCAGGTGTGG + Intergenic
1177566339 21:22827296-22827318 ATACAAAAGTTGGCCAGGTGTGG - Intergenic
1177620826 21:23590917-23590939 ATACAATAGTGGGCCAGGCGTGG - Intergenic
1177695344 21:24564502-24564524 GTAGATGAGGGGGCCAGGCGTGG + Intergenic
1178039218 21:28620959-28620981 GAAGAAAAGAGGGCCAGGTGCGG - Intergenic
1178292143 21:31377844-31377866 AAAAAAAAGTGGGCCAGGTGCGG + Intronic
1178922862 21:36750408-36750430 GTAGAGCAGTGGGCTGGGTGTGG + Intergenic
1179151800 21:38815638-38815660 AAAGAAAAGAGGGCCAGGTGCGG + Intronic
1179179321 21:39031827-39031849 GCAGAGCAGTGGGCCAGGGGAGG - Intergenic
1179473516 21:41628154-41628176 ATAGAACAAGGGGCCAGGTGTGG - Intergenic
1179848186 21:44122783-44122805 GTAGAAAAATTAGCCAGGTGTGG + Intronic
1179860966 21:44188112-44188134 GGAGCATATAGGGCCAGGTGCGG - Intergenic
1179877374 21:44276520-44276542 CTAGGATTCTGGGCCAGGTGTGG - Intergenic
1180691180 22:17717319-17717341 TTAGAAGAGTTAGCCAGGTGTGG + Intronic
1180795557 22:18602965-18602987 TTAAAAAAGTAGGCCAGGTGCGG - Intergenic
1180939589 22:19649694-19649716 ATAGAAGAGTTGGCCAGGTGTGG + Intergenic
1180943954 22:19679536-19679558 GCAGATAAGTGGCCCAGGTGTGG - Intergenic
1181226172 22:21392307-21392329 TTAAAAAAGTAGGCCAGGTGCGG + Intergenic
1181252465 22:21542509-21542531 TTAAAAAAGTAGGCCAGGTGCGG - Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181512057 22:23393563-23393585 GTAGGCTAGTGGGCCCGGCGGGG + Intergenic
1181526252 22:23490186-23490208 GTTGGATAGCTGGCCAGGTGTGG + Intergenic
1181581090 22:23828496-23828518 GTAGAAAAATTAGCCAGGTGTGG + Intronic
1181796585 22:25316022-25316044 GTGTAATATTGGGCCAGGTGCGG - Intergenic
1182377657 22:29859574-29859596 AAAGAATAGTGGGCCAGGCGAGG + Intergenic
1182472882 22:30559527-30559549 GTATAAAAATGGGCCAGGCGCGG - Intronic
1182587852 22:31355769-31355791 GTATAAAAGTTAGCCAGGTGTGG - Intergenic
1182599110 22:31445997-31446019 ATAAAATTCTGGGCCAGGTGCGG + Intronic
1182610248 22:31541464-31541486 TTAGAATTGTAGGCCAGGCGTGG + Intronic
1182744824 22:32597504-32597526 AAAGAATAATGGGCCAGGCGCGG - Intronic
1182926912 22:34133807-34133829 AAAGATTTGTGGGCCAGGTGTGG + Intergenic
1182957020 22:34436160-34436182 GTAGCTTAGAGGGCCAGGCGCGG + Intergenic
1183436743 22:37800631-37800653 GTAGAACAAGGGGCCAGGCGTGG + Intergenic
1183506300 22:38210902-38210924 GTACAAAAATTGGCCAGGTGTGG + Intronic
1183718271 22:39547024-39547046 GAAGAACTGTGGGCCAGGTTAGG + Intergenic
1184462947 22:44649707-44649729 ATAGAAGACAGGGCCAGGTGCGG + Intergenic
1184597828 22:45524926-45524948 ATAGAAAAGTTAGCCAGGTGTGG + Intronic
1184699446 22:46160584-46160606 AAACAATATTGGGCCAGGTGCGG - Intronic
1185135563 22:49069907-49069929 TTAGAATACTGGGCCAGGCGCGG - Intergenic
1185264791 22:49895359-49895381 TTTTAAAAGTGGGCCAGGTGTGG + Intergenic
1185265031 22:49896929-49896951 CTTTAAAAGTGGGCCAGGTGTGG - Intergenic
949551080 3:5113654-5113676 ATAGAAAAGGGGGCAAGGTGGGG - Intergenic
949658258 3:6247132-6247154 GAATAAATGTGGGCCAGGTGCGG + Intergenic
949704735 3:6803370-6803392 TAAGAAAAGTGGGCCAGGTGCGG - Intronic
949919193 3:8988012-8988034 GTAGAGTGGTGGGGCGGGTGGGG - Intronic
950048705 3:9969113-9969135 ATACAAAAATGGGCCAGGTGCGG - Intronic
950235996 3:11320576-11320598 GTAAAATTATGGACCAGGTGTGG - Intronic
950363628 3:12467735-12467757 GTACAATTGGGGGCCAGGTGCGG - Intergenic
950796994 3:15518234-15518256 AAAGAATAGTAGGCCAGGCGCGG - Intronic
950855474 3:16100705-16100727 TTAACATAGTGGGCCAGGCGTGG + Intergenic
951339545 3:21468112-21468134 GTAGTATATGGAGCCAGGTGTGG + Intronic
952265318 3:31780000-31780022 GAACAATAATAGGCCAGGTGTGG + Intronic
952323088 3:32296261-32296283 GTAGAAGTCTGGGTCAGGTGTGG - Intronic
952352446 3:32553177-32553199 ATAGAAAAATTGGCCAGGTGTGG + Intronic
952372825 3:32739767-32739789 ATACAAAAGTTGGCCAGGTGTGG + Intronic
952739014 3:36717388-36717410 GTAGAATAGGAGGCTGGGTGTGG - Intronic
952764072 3:36940173-36940195 GAATAATGGTGGGCCAGGCGCGG - Intronic
952824512 3:37513905-37513927 GTACAATACTGGGCAATGTGCGG + Intronic
954118391 3:48479879-48479901 GTGGAAATGTAGGCCAGGTGTGG - Intronic
954466192 3:50656402-50656424 GTAAAGTAAAGGGCCAGGTGGGG - Intergenic
954530899 3:51319574-51319596 ATGCAATAGTGGGCCAGGTGTGG + Intronic
955889054 3:63631368-63631390 GGAGAATAAGGGGACAGGTGGGG - Intergenic
955951814 3:64250384-64250406 CTAGGGGAGTGGGCCAGGTGGGG + Intronic
956056427 3:65303517-65303539 GGAGAATTGTGGAACAGGTGTGG + Intergenic
956196178 3:66655397-66655419 GTGGAATAGTGGGGCAAGGGTGG + Intergenic
956552740 3:70479817-70479839 ATAAAATAGTGGGCCAGATTTGG - Intergenic
957024053 3:75159504-75159526 GAATCATAATGGGCCAGGTGTGG - Intergenic
957450620 3:80377285-80377307 GAAGTACAGTAGGCCAGGTGTGG - Intergenic
960377182 3:116917701-116917723 AAAGAAAAGTCGGCCAGGTGTGG + Intronic
960609650 3:119543714-119543736 TTAGAGAATTGGGCCAGGTGCGG - Intronic
960792372 3:121447451-121447473 GTTAAAAAGTGGGCCAGGCGCGG - Intronic
961690705 3:128667432-128667454 GTAAAGTAGTGAGCCCGGTGTGG - Intronic
963243125 3:143030753-143030775 GAACATTTGTGGGCCAGGTGTGG + Intronic
963943174 3:151115765-151115787 ATAGTATAATGGGCCAGGTGGGG + Intronic
964348742 3:155781785-155781807 AAAAAATAGTGGGCCGGGTGCGG + Intronic
964568091 3:158080550-158080572 GAAGAACATTGGGCCAGGTGTGG + Intergenic
964705351 3:159612589-159612611 GTAGAAAAATTAGCCAGGTGTGG + Intronic
965595488 3:170406599-170406621 GTAGTAAGGTGGGCTAGGTGTGG - Intergenic
965985727 3:174750722-174750744 GAAGAATAATAGGCCGGGTGCGG - Intronic
966713862 3:182996292-182996314 AAAGAATTGAGGGCCAGGTGCGG - Intergenic
968312888 3:197698701-197698723 GAAAAATTCTGGGCCAGGTGTGG + Intronic
968333547 3:197893065-197893087 TTAAAATAGGGGGCCAGGCGCGG + Intronic
969236542 4:5869390-5869412 GAAGTAAACTGGGCCAGGTGTGG + Intronic
970587229 4:17526267-17526289 TTGGAAGAGTGGGCCGGGTGCGG + Intronic
970688587 4:18596213-18596235 ATAAAAAAGTTGGCCAGGTGCGG - Intergenic
972039679 4:34577229-34577251 GAAGAATAATGGGCCGGGTATGG - Intergenic
972388870 4:38593702-38593724 TAAGAGTAGTAGGCCAGGTGTGG - Intergenic
972801636 4:42482010-42482032 GAACAGTAGTTGGCCAGGTGCGG + Intronic
973095239 4:46189555-46189577 GTGTGAGAGTGGGCCAGGTGCGG + Intergenic
973303158 4:48612877-48612899 ATAGAACAGTTGGCCGGGTGCGG - Intronic
974381228 4:61142920-61142942 ATAGAAGAAGGGGCCAGGTGAGG + Intergenic
974708649 4:65558165-65558187 TAAGAATTTTGGGCCAGGTGTGG - Intronic
975875766 4:78835333-78835355 GTCAAATAGTTGGCCTGGTGCGG + Intronic
976229323 4:82824493-82824515 GAAGAATCCTTGGCCAGGTGTGG - Intronic
976783241 4:88785835-88785857 GTATCATAGTGTGCCAGGTTAGG + Intronic
977039147 4:91993436-91993458 GTAGAAAAAGGGGCCAGGTGCGG + Intergenic
977921193 4:102644591-102644613 GTAGAATGGTGGGCTGGATGGGG + Intronic
978712375 4:111800020-111800042 GTAGAATCCTGGACCTGGTGTGG + Intergenic
980077234 4:128306662-128306684 AGAGTATAATGGGCCAGGTGTGG - Intergenic
981211293 4:142109089-142109111 GAGGAATAGTGGGTAAGGTGAGG - Intronic
981258579 4:142692408-142692430 GTATCAAATTGGGCCAGGTGGGG + Intronic
981475779 4:145185252-145185274 AAAGAATTATGGGCCAGGTGTGG - Intergenic
981790997 4:148536186-148536208 GTACAAAAGTTAGCCAGGTGTGG - Intergenic
981930452 4:150183886-150183908 ATAGAAAAATGAGCCAGGTGTGG - Intronic
982041222 4:151398998-151399020 CTAGAATAGTTGGCCGGGCGCGG + Intergenic
982134941 4:152266538-152266560 GTTAAAGAGAGGGCCAGGTGTGG + Intergenic
983318924 4:166169707-166169729 ACAAAATAGTGGACCAGGTGCGG - Intergenic
983670660 4:170233481-170233503 TTAGAGTACAGGGCCAGGTGTGG - Intergenic
983777974 4:171632099-171632121 GAAAAATAATGGGCCAGGCGCGG + Intergenic
984117498 4:175700151-175700173 ATAGAGTTGTGGGCCGGGTGTGG - Intronic
984408557 4:179366299-179366321 GAAGATAAGTGGGCCGGGTGTGG + Intergenic
984768488 4:183418188-183418210 ATAAAATACTAGGCCAGGTGAGG + Intergenic
984783041 4:183543279-183543301 GTAGAAAAATTAGCCAGGTGTGG + Intergenic
984797830 4:183681488-183681510 GTAAATTAATGGGCCGGGTGCGG + Intronic
984870616 4:184321800-184321822 GTATAACATTTGGCCAGGTGCGG + Intergenic
984974070 4:185214938-185214960 CTAGAATAATGGGCCTGGCGCGG + Intronic
985820107 5:2153831-2153853 GGAGAATAGTGGGCCAGCGATGG + Intergenic
985820114 5:2153875-2153897 GGAGAATAGTGGGCCAGCGATGG + Intergenic
985858355 5:2448857-2448879 GTACTAAATTGGGCCAGGTGTGG - Intergenic
986554362 5:8996310-8996332 GAAAACAAGTGGGCCAGGTGTGG - Intergenic
986749581 5:10774973-10774995 TTAAAATACTTGGCCAGGTGCGG - Intergenic
988490244 5:31699879-31699901 ATAAAATAGAGGGCCAAGTGCGG - Intronic
989387681 5:40869435-40869457 ATAGAATGGTAGGCCAGGTGTGG - Intergenic
989571049 5:42946502-42946524 TTACCATTGTGGGCCAGGTGGGG + Intergenic
989581302 5:43035912-43035934 TTACCATTGTGGGCCAGGTGGGG + Intergenic
990372659 5:55136401-55136423 GTACAAAAATTGGCCAGGTGTGG + Intronic
991073502 5:62513027-62513049 ATAGAAAAGGGGGCAAGGTGGGG - Intronic
991382985 5:66051737-66051759 GTACAAAAGTTGGCCATGTGTGG + Intronic
991444525 5:66684969-66684991 AAAGAATAGCTGGCCAGGTGGGG + Intronic
992108913 5:73474182-73474204 ATAGAAAAATTGGCCAGGTGTGG + Intergenic
992185122 5:74237134-74237156 GTAGACTCCTGGGCCAGCTGGGG + Intergenic
992416734 5:76559189-76559211 GAAAAACAGAGGGCCAGGTGCGG - Intronic
992880938 5:81109364-81109386 TTAAAATAATAGGCCAGGTGCGG + Intronic
993229890 5:85221048-85221070 GTAGAAAACTGGGCCGGGAGCGG - Intergenic
993903409 5:93599054-93599076 GTAGAAGAGAAGGCCAGGGGTGG - Intergenic
994376596 5:99021966-99021988 GTAGATTAGAAAGCCAGGTGTGG - Intergenic
994622131 5:102176397-102176419 AGAAAAAAGTGGGCCAGGTGTGG - Intergenic
994753575 5:103767659-103767681 ATAGATTAGTAGGCCAGGTGTGG - Intergenic
994780722 5:104086547-104086569 TTAGATTGGTGGGCCAGGTGTGG - Intergenic
995091465 5:108183327-108183349 GTAGAAAACTGGGCCAGGCGTGG - Intronic
996020887 5:118589536-118589558 TTAAAACAGGGGGCCAGGTGTGG + Intergenic
997310947 5:132882055-132882077 GTAGAAAAATTAGCCAGGTGTGG + Intronic
997313524 5:132912060-132912082 ATAGTAAAATGGGCCAGGTGCGG + Intronic
997403801 5:133626491-133626513 TTAGAAAAGAGGGCCAAGTGCGG - Intergenic
998066287 5:139161724-139161746 TTAGAATTGCTGGCCAGGTGCGG + Intronic
998313037 5:141154116-141154138 ATAAAATAGTCAGCCAGGTGTGG - Intergenic
998937721 5:147248588-147248610 GTAGAACAGTGGGGCAGGATGGG - Intronic
999175892 5:149631459-149631481 GTATAGAACTGGGCCAGGTGTGG - Intronic
999297887 5:150471926-150471948 TTAGAAAATTAGGCCAGGTGTGG + Intergenic
999460773 5:151756230-151756252 GGATAATAATAGGCCAGGTGCGG - Intronic
999790237 5:154932853-154932875 TTAGAAGAGTTGGCCGGGTGTGG - Intronic
1000083672 5:157870262-157870284 ATAGAATAGTTGGCTGGGTGTGG + Intergenic
1000350818 5:160351038-160351060 TTAGCACTGTGGGCCAGGTGTGG - Intronic
1000571914 5:162925283-162925305 GAAGAAAATTGGGCCAGGTGCGG + Intergenic
1000802960 5:165751639-165751661 TAAAAATAGTGGGCCAGGCGAGG - Intergenic
1001112216 5:168906123-168906145 TTAAAATATTGGGCAAGGTGGGG - Intronic
1001162281 5:169331136-169331158 ATAGAAAAGTTAGCCAGGTGTGG - Intergenic
1001188280 5:169599784-169599806 GAAGAACAGTGAGCCAGGCGTGG + Intronic
1002396626 5:178961217-178961239 CTAAGATTGTGGGCCAGGTGTGG - Intronic
1003091837 6:3110496-3110518 AGAGTATAGTGGGCCAGGTGCGG - Intronic
1003108740 6:3235641-3235663 GCAGACTAGTGGGCCAGTTGGGG - Intronic
1003735558 6:8874160-8874182 ATAGAATATAGGGCCGGGTGCGG - Intergenic
1004228627 6:13811631-13811653 GTAGAGTTCTGGGGCAGGTGAGG - Intronic
1004427938 6:15518770-15518792 TTAAAAGAATGGGCCAGGTGTGG - Intronic
1004612870 6:17262414-17262436 GTACAAAAGTTAGCCAGGTGTGG + Intergenic
1004649280 6:17593005-17593027 TTAGAAATGTGGGCCAGGTGTGG - Intergenic
1004867839 6:19871306-19871328 GAAGGAAAGTTGGCCAGGTGTGG - Intergenic
1005133438 6:22538606-22538628 GTAGCATAGAGGGTCAGGTGGGG - Intergenic
1005281030 6:24273990-24274012 GAAGAATACTGGCCCATGTGTGG + Intronic
1005631927 6:27716604-27716626 ATAGAAAAATTGGCCAGGTGTGG - Intergenic
1005986092 6:30876196-30876218 GTGGAATATTGTGCCAAGTGCGG - Intergenic
1006030355 6:31173006-31173028 GTAGATTATGGGGCCTGGTGGGG + Intronic
1006076499 6:31536032-31536054 GTATTCTAGTGTGCCAGGTGGGG - Intronic
1006330584 6:33387765-33387787 ATGGAATGGTAGGCCAGGTGCGG + Intergenic
1006542475 6:34751706-34751728 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1006633353 6:35445127-35445149 GTAGAAAATAGGGCCAGGCGCGG - Intergenic
1006664726 6:35684332-35684354 GTACAAAAGTTAGCCAGGTGTGG - Intronic
1006949562 6:37810249-37810271 GTAAAAAAGTTAGCCAGGTGTGG + Intergenic
1007638297 6:43314781-43314803 GTAAAACATTTGGCCAGGTGCGG + Intronic
1007669883 6:43543173-43543195 TCAGAATAGTGGGCTGGGTGAGG + Intronic
1007680756 6:43631774-43631796 ATAAAATAGTAGGTCAGGTGTGG - Intronic
1007875941 6:45101133-45101155 GTAAAAAAGTTGGCCAGGCGCGG + Intronic
1008113659 6:47521259-47521281 GTGGCATAGTAGGCCAGGCGTGG + Intronic
1010138604 6:72585945-72585967 TAAGAATTTTGGGCCAGGTGTGG - Intergenic
1010448554 6:75976619-75976641 TTAGAATCCTTGGCCAGGTGCGG + Intronic
1010950821 6:82034999-82035021 TTAAAATAATTGGCCAGGTGCGG - Intergenic
1011389240 6:86833537-86833559 ATAGAAAAGAGGGCCGGGTGTGG - Intergenic
1011585420 6:88919607-88919629 ATAAAATTGTGGGCCAGGTGTGG - Intronic
1011610820 6:89148267-89148289 TTAGAAGAGTGGGCCGGGAGCGG - Intronic
1011719078 6:90136535-90136557 GGTAAATAGTGGGCCAGGGGAGG - Intronic
1012572390 6:100745036-100745058 AAGGAAAAGTGGGCCAGGTGCGG + Intronic
1012928905 6:105296591-105296613 GTATAATAGTTGGCCATTTGGGG - Intronic
1013034483 6:106367296-106367318 AAAAAATATTGGGCCAGGTGTGG + Intergenic
1013238876 6:108224568-108224590 GCAGCTAAGTGGGCCAGGTGTGG - Intronic
1013724864 6:113081899-113081921 ATAGAATGATGGGCCAGGAGTGG + Intergenic
1013887597 6:114988890-114988912 GTAGGAAAGGGGGCCTGGTGCGG - Intergenic
1014560622 6:122885641-122885663 GTTATATAATGGGCCAGGTGCGG + Intergenic
1015116585 6:129656351-129656373 GTAGCACAGTAGGCCAGGTGCGG + Intronic
1015319954 6:131861877-131861899 CTAGACAAGTGGGCCAGCTGTGG + Intronic
1015584213 6:134758985-134759007 GTACACTCTTGGGCCAGGTGCGG + Intergenic
1015720634 6:136237519-136237541 TTAAAAATGTGGGCCAGGTGTGG + Intronic
1016030650 6:139333945-139333967 GTAAAATGTTTGGCCAGGTGTGG + Intergenic
1017129725 6:151097882-151097904 ATAAAATATTAGGCCAGGTGTGG + Intronic
1017168115 6:151428822-151428844 TTATAAGTGTGGGCCAGGTGTGG - Intronic
1017179102 6:151533342-151533364 ATGAAATAGTCGGCCAGGTGCGG - Intronic
1017689180 6:156946064-156946086 GAAGAATAATGGGCCAGGCGTGG + Intronic
1017828884 6:158106542-158106564 ATAAAATAGTGGGCCAGGTATGG + Intergenic
1017933215 6:158978827-158978849 TTAAAATATTGGGCAAGGTGTGG - Intronic
1018062027 6:160097623-160097645 GTAAAATGGTGGGCCAGGCCGGG - Intronic
1018214798 6:161516535-161516557 GAAGAAAAGTGGGCTAGGTATGG + Intronic
1018248122 6:161841638-161841660 GTCTAAAAGTGGGCCAGGCGTGG - Intronic
1019810804 7:3163909-3163931 ATACAAAAGTTGGCCAGGTGAGG - Intronic
1020063373 7:5169174-5169196 GTACAAAAATTGGCCAGGTGCGG + Intergenic
1020135124 7:5583273-5583295 GAAAAAAAGTGGGCCAGGTGTGG + Intergenic
1020216213 7:6192821-6192843 ATTGACTTGTGGGCCAGGTGTGG - Intronic
1021220437 7:17969695-17969717 TTCGAGTAGTTGGCCAGGTGTGG + Intergenic
1021266311 7:18528159-18528181 GTAAAAAAGTAAGCCAGGTGTGG + Intronic
1021398748 7:20183996-20184018 TTAGAATCAGGGGCCAGGTGTGG - Intronic
1021488424 7:21192298-21192320 TTAGAATAATAGGCCAGGTGCGG + Intergenic
1021506959 7:21396627-21396649 ATACAAAAGTGAGCCAGGTGTGG - Intergenic
1022087217 7:27080163-27080185 GAACTAAAGTGGGCCAGGTGCGG - Intergenic
1023044300 7:36197465-36197487 ATAGAAAAGGGGGCAAGGTGGGG + Intronic
1023210828 7:37803145-37803167 GTAGATGGATGGGCCAGGTGTGG - Intronic
1023293803 7:38693846-38693868 GTACAAAAATTGGCCAGGTGTGG - Intergenic
1023579912 7:41670753-41670775 ATAGAAAAATGGGCCGGGTGTGG + Intergenic
1024285653 7:47755345-47755367 ACAGAATCATGGGCCAGGTGAGG - Intronic
1025059681 7:55794939-55794961 GTAGAAAATAAGGCCAGGTGTGG - Exonic
1025927756 7:65973038-65973060 GAAGAAAAGGGGGCCAGGTGTGG + Intronic
1026020816 7:66704518-66704540 TTTAAATAGTCGGCCAGGTGCGG + Intronic
1026049231 7:66931010-66931032 GATGAATGGTGGGCCTGGTGTGG + Intronic
1026940593 7:74285636-74285658 TTAAAATTGTGGGCCAGTTGTGG - Intergenic
1027134314 7:75613270-75613292 GGAGAGTAGAGGGACAGGTGAGG + Intronic
1027193351 7:76010922-76010944 ATACACTAGTTGGCCAGGTGTGG + Intronic
1028529854 7:91826634-91826656 GTAGCATAGTGGGCCCACTGGGG - Intronic
1028723478 7:94060512-94060534 ATAAAACAATGGGCCAGGTGCGG + Intergenic
1029286978 7:99472556-99472578 GAAGAAAAATGGGCCAGGCGCGG - Intergenic
1029379796 7:100205539-100205561 ATCAAATAGAGGGCCAGGTGTGG + Intronic
1030009833 7:105154961-105154983 GAATAAGGGTGGGCCAGGTGCGG - Intronic
1030201013 7:106904049-106904071 TCAGAAAAGTGGGCCTGGTGCGG - Intronic
1030242590 7:107344812-107344834 GTAAAACAGTCGGCCAGGCGCGG - Intronic
1030627673 7:111861454-111861476 GTATAATATTAGGCCGGGTGTGG + Intronic
1030774121 7:113512837-113512859 GTAGGATAGGGGGCCAGGGGCGG - Intergenic
1031504077 7:122559478-122559500 TAAGAAGAGAGGGCCAGGTGCGG + Intronic
1031600402 7:123700726-123700748 GTAGAATAGTTGGCCGGGCACGG - Intronic
1031825182 7:126556354-126556376 AAAAAAAAGTGGGCCAGGTGTGG + Intronic
1032028307 7:128460989-128461011 GGGGAGTAGTGGGCCGGGTGCGG - Intergenic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032210867 7:129912959-129912981 GTACAACATTGGGCCAGGTGCGG + Intronic
1032222560 7:130005770-130005792 GGAAAATTTTGGGCCAGGTGCGG - Intergenic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1034121416 7:148631454-148631476 AAAGAAGAGGGGGCCAGGTGTGG + Intergenic
1034540006 7:151751801-151751823 AGAGAGTAGTTGGCCAGGTGAGG - Intronic
1034716746 7:153250366-153250388 GTAAAAAATTGGGCCAGGTGTGG + Intergenic
1034733246 7:153406117-153406139 GTACAATTCTAGGCCAGGTGCGG - Intergenic
1034920173 7:155073028-155073050 TAAGAATTGAGGGCCAGGTGCGG + Intronic
1035172374 7:157024494-157024516 GTAGAATGATAGGCCAGGGGCGG - Intergenic
1037136772 8:15471906-15471928 TTAGAACTGGGGGCCAGGTGTGG - Intronic
1037436727 8:18870941-18870963 GTACAAAAGTTGGCCAGGTGTGG + Intronic
1037486941 8:19356713-19356735 GGAGAATTGTGGGCCAGGCAGGG + Intronic
1037673004 8:21031245-21031267 GTAGAACTGTGGGCCGGGAGTGG + Intergenic
1037871211 8:22498832-22498854 GTAGAATTATTGGCCGGGTGCGG + Intronic
1038057939 8:23879470-23879492 ATAAATTAGTGGGCCAGGTGGGG - Intergenic
1038064376 8:23947556-23947578 ATAGAAAAATAGGCCAGGTGCGG - Intergenic
1038307546 8:26418343-26418365 TAAAAATACTGGGCCAGGTGTGG + Intronic
1038423903 8:27452278-27452300 TGAGAATAGAAGGCCAGGTGTGG + Intronic
1039125575 8:34197551-34197573 GAAGAGTAGGGGGCAAGGTGAGG - Intergenic
1039558451 8:38494153-38494175 GAAGAAAAATGGGCCAGGTGTGG + Intergenic
1039812160 8:41058813-41058835 GTATAAAATGGGGCCAGGTGTGG + Intergenic
1040973370 8:53162499-53162521 GAAGATTAATTGGCCAGGTGAGG + Intergenic
1041766263 8:61421298-61421320 GCAGCAAAGTGGGCCTGGTGAGG + Intronic
1042238479 8:66639138-66639160 ATAGAAAAATTGGCCAGGTGTGG - Intronic
1042248963 8:66737117-66737139 TAAGAATATCGGGCCAGGTGTGG - Intronic
1042363018 8:67903703-67903725 GTTGAAAAGTCAGCCAGGTGCGG - Intergenic
1042485961 8:69345983-69346005 ATAGAAAAATAGGCCAGGTGTGG + Intergenic
1042967874 8:74375035-74375057 GAAAAATATTGGGCCAGGTGTGG + Intronic
1044060763 8:87632054-87632076 ATAGAAAAATAGGCCAGGTGTGG - Intergenic
1044394227 8:91691097-91691119 GTAGAAACATGGGCCAGGCGTGG + Intergenic
1044745170 8:95364449-95364471 TTAGAAAAGGGGGCCAGGTGTGG - Intergenic
1045499275 8:102732456-102732478 TTAAAAAAGTAGGCCAGGTGTGG + Intergenic
1045735622 8:105293286-105293308 AAAGAAGAGTGGGCCTGGTGCGG + Intronic
1046080910 8:109369265-109369287 GTATAATTCTAGGCCAGGTGCGG - Intronic
1046916233 8:119680930-119680952 ATAGAAAAATTGGCCAGGTGTGG + Intergenic
1046932172 8:119852643-119852665 GAAGAAATTTGGGCCAGGTGTGG - Intronic
1047385521 8:124405754-124405776 AAAGAAGATTGGGCCAGGTGCGG - Intergenic
1047391849 8:124458857-124458879 GTACAAAAATTGGCCAGGTGCGG + Intronic
1047593247 8:126349646-126349668 AAAGAATAGTCGGCCAGGCGCGG + Intergenic
1047736230 8:127767666-127767688 ATAGAACAGGTGGCCAGGTGCGG - Intergenic
1047832130 8:128645569-128645591 GTAAAATGTTGGGCCAGGCGCGG - Intergenic
1048052993 8:130836887-130836909 ATAGAAAAGTTAGCCAGGTGTGG - Intronic
1049628562 8:143638183-143638205 GTACAAAAGTTAGCCAGGTGTGG + Intronic
1050304468 9:4294216-4294238 ACAGAATAATGGGCCAGGTGCGG + Intronic
1050568102 9:6908525-6908547 GGAGCATGTTGGGCCAGGTGGGG - Intronic
1051568538 9:18528166-18528188 ATAAAAAAATGGGCCAGGTGTGG - Intronic
1051971046 9:22887739-22887761 GTACAAAAATGAGCCAGGTGTGG + Intergenic
1052794471 9:32910679-32910701 GAAGAATTTAGGGCCAGGTGTGG + Intergenic
1052911655 9:33887963-33887985 TTAGAATAGTAGGCCAGGCGCGG - Intronic
1053155613 9:35776575-35776597 TGAGAATAGGGGGCCAGATGCGG - Intergenic
1053391040 9:37736373-37736395 GGTAAATAGTGGGCCCGGTGTGG + Intronic
1053597519 9:39577913-39577935 ATAGTAAAGGGGGCCAGGTGAGG + Intergenic
1053855534 9:42334884-42334906 ATAGTAAAGGGGGCCAGGTGAGG + Intergenic
1055294928 9:74824440-74824462 CAAGAGAAGTGGGCCAGGTGTGG - Intronic
1055306157 9:74930994-74931016 TTAAAATTGTGGGCCGGGTGTGG + Intergenic
1056631945 9:88301205-88301227 GTGGAACAGGAGGCCAGGTGTGG - Intergenic
1056787308 9:89602576-89602598 GTTTAATAGTAGGCCGGGTGCGG + Intergenic
1057174437 9:92985766-92985788 ACAGAAAAATGGGCCAGGTGCGG - Intronic
1057725166 9:97563341-97563363 GTTGAATATAAGGCCAGGTGTGG - Intronic
1057753818 9:97813846-97813868 ATACAAAAGTTGGCCAGGTGTGG + Intergenic
1058305943 9:103440739-103440761 ATTGAATAATAGGCCAGGTGCGG + Intergenic
1058437745 9:104978899-104978921 ATAAAATAGTTGGCCAGGCGTGG + Intergenic
1058546037 9:106060807-106060829 ATAGGATATTTGGCCAGGTGTGG - Intergenic
1059075668 9:111191305-111191327 GATGAATAGGAGGCCAGGTGAGG + Intergenic
1059654933 9:116349030-116349052 ATAGAGGAGAGGGCCAGGTGGGG - Intronic
1060095135 9:120782176-120782198 GTAGAATGGTGGGCCAGGCATGG + Intronic
1060506953 9:124204984-124205006 ATAGAAAAGTTAGCCAGGTGTGG - Intergenic
1060655279 9:125368256-125368278 ATTGAAGAGTGGGCCGGGTGCGG - Intergenic
1060923630 9:127440150-127440172 GTAGATTAGTGGGCCGGGCGCGG - Intronic
1061665872 9:132161045-132161067 GCAGAGTAGTGGGGCAGGAGGGG - Intergenic
1061800433 9:133110633-133110655 GTAGAATTTCAGGCCAGGTGTGG + Intronic
1061827057 9:133265044-133265066 TAAAAATAGAGGGCCAGGTGAGG - Intronic
1186015651 X:5189690-5189712 TTAGAAGAGTGGGCCGGGTGTGG - Intergenic
1186348571 X:8719669-8719691 GTCACATAATGGGCCAGGTGCGG - Intronic
1186600471 X:11031109-11031131 TTAATATAGTGAGCCAGGTGTGG - Intergenic
1187204824 X:17171814-17171836 TTATAATTATGGGCCAGGTGCGG - Intergenic
1187523705 X:20035598-20035620 ATAAAATAGTTGGCCAGGCGTGG + Intronic
1187539189 X:20174635-20174657 GTAGAGTTTTAGGCCAGGTGCGG - Intronic
1187842251 X:23500732-23500754 AAAGAAAAGTTGGCCAGGTGCGG - Intergenic
1188334999 X:28920787-28920809 GAAGACAAGTGGGCCAGGAGTGG + Intronic
1189424846 X:40890210-40890232 GTAAGATAGAAGGCCAGGTGCGG + Intergenic
1189476408 X:41359680-41359702 TTAAAAAAGTGGGCCAGGTGTGG + Intronic
1189778219 X:44488991-44489013 GCAGGATATAGGGCCAGGTGCGG + Intergenic
1189783142 X:44535375-44535397 AAATAATACTGGGCCAGGTGCGG + Intronic
1189865591 X:45323809-45323831 GTAGAAGAGTGGGAAGGGTGGGG - Intergenic
1190234954 X:48608058-48608080 ATAAAAAAGTGGGCCAGGAGCGG - Exonic
1190378908 X:49818811-49818833 AAAGAAAAGTTGGCCAGGTGTGG + Intergenic
1190628775 X:52365047-52365069 ATACAAAAGTTGGCCAGGTGAGG - Intergenic
1190770629 X:53511191-53511213 GTACAAAAATTGGCCAGGTGTGG - Intergenic
1192327067 X:70142040-70142062 AGAGAAGAGTAGGCCAGGTGTGG + Intronic
1193148685 X:78103473-78103495 GAAGTTTAGTGGGCCAGGCGCGG - Intronic
1193379155 X:80798640-80798662 GTATAATATAAGGCCAGGTGTGG + Intronic
1193540565 X:82766807-82766829 ATAAAATAATTGGCCAGGTGTGG - Intergenic
1194088238 X:89555177-89555199 TTAGAAAAGGGGGCCAGGCGTGG + Intergenic
1195023630 X:100853824-100853846 TTAAAATAGTTGGCCAGGAGTGG - Intronic
1195061655 X:101201343-101201365 GTAAAGAACTGGGCCAGGTGTGG - Intergenic
1195225260 X:102785638-102785660 GAAGAATAGTTGGCTGGGTGTGG - Intergenic
1195854861 X:109320141-109320163 GAAAAATTGTGGGCCAGGCGTGG + Intergenic
1195931696 X:110084211-110084233 CAAGAATAGTTGGCCAGGTGTGG + Intronic
1196255861 X:113517547-113517569 GTAAAATAATGGGCCAGTGGAGG - Intergenic
1196678064 X:118441247-118441269 GTAGATTTCAGGGCCAGGTGCGG - Intronic
1196793630 X:119485622-119485644 GCGGAAGGGTGGGCCAGGTGTGG + Intergenic
1196799213 X:119527228-119527250 TTAGAAAAGTTGGCCAGTTGCGG - Intergenic
1196816633 X:119670265-119670287 AAAGAATAATAGGCCAGGTGTGG + Intronic
1197740832 X:129892311-129892333 ATAGAATTCTGGGCCAGGTGTGG - Intergenic
1197973829 X:132143846-132143868 GTAGAATTGTCAGCCAGATGTGG - Intergenic
1198317437 X:135483215-135483237 GCAGAATAATTGACCAGGTGCGG + Intergenic
1200421793 Y:2977488-2977510 CTACAATTGGGGGCCAGGTGTGG + Intronic
1200683240 Y:6237724-6237746 TTAAAAAAATGGGCCAGGTGCGG + Intergenic
1200749772 Y:6934236-6934258 GTAGAGAAGGGGGGCAGGTGTGG - Intronic
1200805301 Y:7427722-7427744 ATACAAAAGTGAGCCAGGTGTGG + Intergenic
1200816213 Y:7535573-7535595 GTAAAATAGTGGGCCACATTGGG - Intergenic
1201049394 Y:9916661-9916683 TTAAAAAAATGGGCCAGGTGCGG - Intergenic
1201665040 Y:16442188-16442210 AAAGAAGAGTGGTCCAGGTGTGG + Intergenic
1201772645 Y:17631079-17631101 GTACAACAATTGGCCAGGTGTGG + Intergenic
1201828910 Y:18274908-18274930 GTACAACAATTGGCCAGGTGTGG - Intergenic
1202391384 Y:24373783-24373805 ATACAAAAGTTGGCCAGGTGTGG + Intergenic
1202479401 Y:25296334-25296356 ATACAAAAGTTGGCCAGGTGTGG - Intergenic