ID: 1064736889

View in Genome Browser
Species Human (GRCh38)
Location 10:18391164-18391186
Sequence AAATGCCAACTTAATTAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064736889_1064736894 4 Left 1064736889 10:18391164-18391186 CCAAGTTAATTAAGTTGGCATTT 0: 1
1: 0
2: 3
3: 16
4: 273
Right 1064736894 10:18391191-18391213 AGGTTTGTGATAAAACACTGGGG No data
1064736889_1064736892 2 Left 1064736889 10:18391164-18391186 CCAAGTTAATTAAGTTGGCATTT 0: 1
1: 0
2: 3
3: 16
4: 273
Right 1064736892 10:18391189-18391211 GGAGGTTTGTGATAAAACACTGG No data
1064736889_1064736893 3 Left 1064736889 10:18391164-18391186 CCAAGTTAATTAAGTTGGCATTT 0: 1
1: 0
2: 3
3: 16
4: 273
Right 1064736893 10:18391190-18391212 GAGGTTTGTGATAAAACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064736889 Original CRISPR AAATGCCAACTTAATTAACT TGG (reversed) Intronic
900281244 1:1870775-1870797 AAATGCAAAATAAATTAGCTGGG + Intronic
901331694 1:8414219-8414241 AAATCCCAACTTTGTCAACTGGG + Intronic
902125394 1:14205723-14205745 AAATGCAAAATAAATTAGCTGGG + Intergenic
902190814 1:14761837-14761859 AAATCCCTCTTTAATTAACTGGG - Intronic
903789505 1:25882922-25882944 TAATGTCACCTTAATTAGCTGGG + Intergenic
905688377 1:39925263-39925285 AAATACAAACTAAATTAGCTGGG + Intergenic
906931378 1:50172988-50173010 AAATGCAAAATTAATTCCCTGGG + Intronic
909634874 1:77806087-77806109 AAATACCACCCTAATTAATTAGG + Intronic
909777388 1:79498806-79498828 AAAGGCCAAGTAAAGTAACTAGG - Intergenic
910120766 1:83787413-83787435 AAATGCCACATTATTTAAATTGG + Intergenic
912161782 1:106994274-106994296 ATGTGCCAACCTAAGTAACTTGG + Intergenic
915704873 1:157834283-157834305 CATTGCAAACTTATTTAACTGGG - Intronic
917074513 1:171190277-171190299 AAGTGCTATCTGAATTAACTTGG + Intronic
918192108 1:182185669-182185691 ATATGTCAACTTGATTAACCTGG - Intergenic
918387413 1:184024059-184024081 AAATGCCATCTTAAATAATGTGG + Intronic
918627456 1:186673561-186673583 AAATGCCAAATTTATTAAGGTGG - Exonic
918687692 1:187439424-187439446 AATTGCCAACATAATTAAATGGG - Intergenic
919007367 1:191914842-191914864 AAGTGCAAACTGAATAAACTAGG + Intergenic
919346613 1:196388182-196388204 CGATGCCAAGTTAATTACCTTGG - Intronic
920005967 1:202833995-202834017 AAATACCAAATAAATTAGCTGGG + Intergenic
921419856 1:214933892-214933914 AAAATCCAACTTAATTTAGTTGG - Intergenic
921458753 1:215404111-215404133 AAATGCCAGGTGAATTAAGTTGG - Intergenic
921827020 1:219683770-219683792 AAAGGCCAACTTAACAAATTAGG + Intergenic
922039237 1:221879928-221879950 AAATGCTAAGTTATTTAATTTGG - Intergenic
922438182 1:225627296-225627318 AGATGCCAGCTTATTTATCTAGG + Intronic
924168286 1:241308363-241308385 AATTGACAACTTAAATAACATGG - Intronic
1063004412 10:1954209-1954231 AAATGCCAACATATTTGGCTAGG - Intergenic
1064736889 10:18391164-18391186 AAATGCCAACTTAATTAACTTGG - Intronic
1065160387 10:22914035-22914057 TAATGCCAACTTACTAGACTAGG + Intergenic
1066018834 10:31276294-31276316 ACATGTCAACTGAATTAATTGGG - Intergenic
1067895472 10:50174837-50174859 AAATGCCAAATGAATCATCTGGG - Intergenic
1067929887 10:50550047-50550069 AAATGCAGACTCCATTAACTTGG + Intronic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1071670914 10:87608668-87608690 AAATGCACACTTATTGAACTGGG + Intergenic
1072819121 10:98538727-98538749 AAAAGCCACATTAATTAAGTAGG - Intronic
1072827363 10:98620852-98620874 GAATGCCAACTCACTGAACTGGG - Intronic
1072886316 10:99278122-99278144 AACTGCAAACTTAATAAATTAGG + Intergenic
1074125304 10:110524528-110524550 GAATGCCAAGTTAAATAACTGGG - Intergenic
1074579398 10:114704176-114704198 AAATGCCAAATAAATTATGTTGG - Intergenic
1074602011 10:114924114-114924136 AAATGGCAACTCACTAAACTGGG - Intergenic
1074937574 10:118200281-118200303 AAATGCCAATTAAATCAAGTTGG + Intergenic
1075418277 10:122281763-122281785 AAATGCCAATTTGATTAACTAGG - Intronic
1075644798 10:124090484-124090506 AAATTCCAAGTTAACTAGCTGGG - Intronic
1080970032 11:37262751-37262773 ATTTGCCAGCTTATTTAACTGGG + Intergenic
1081175888 11:39925896-39925918 AAATGGCAATTTAATCAAATGGG + Intergenic
1081294840 11:41372530-41372552 AAATGCCCACTTATCAAACTTGG - Intronic
1083031658 11:59598181-59598203 AAATGTCGAAGTAATTAACTGGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1086189593 11:84063163-84063185 AACTGTCAACTTAATTAGATTGG - Intronic
1087280505 11:96204241-96204263 GAATGACTATTTAATTAACTTGG - Intronic
1087564994 11:99844256-99844278 AAAAGACAACTTAATTAAAATGG - Intronic
1088337811 11:108727997-108728019 AAATGCAAATTTTATTAAGTTGG + Intronic
1090195702 11:124814941-124814963 AAATGACAAATTAAATAATTAGG - Intergenic
1093437565 12:19153427-19153449 AAATACAAACTTTATTAACTTGG - Intronic
1093566114 12:20605946-20605968 AATTGATAACTTAATTAAATAGG - Intronic
1094681637 12:32672545-32672567 AGATGCCAAGTTACTTAGCTAGG - Intergenic
1094753005 12:33435671-33435693 AAATGATAACTCAATTAATTGGG + Intronic
1097657298 12:62382297-62382319 AAATGCCTACTTAATTATATAGG + Intronic
1097920702 12:65069500-65069522 AAATATTAACTTCATTAACTCGG - Intronic
1099336553 12:81366558-81366580 AAATGCCAAATTAGTGAAGTAGG - Intronic
1099366915 12:81777385-81777407 AAATGACAACTTGGTGAACTAGG - Intergenic
1100097617 12:91061737-91061759 AAATGTTAACTTAATTAAAAAGG - Intergenic
1103250890 12:119499151-119499173 AAATGCCAAAATTATTAATTTGG + Intronic
1103260835 12:119586988-119587010 AAATACCAACAAAATTAACTGGG - Intergenic
1105491088 13:20888968-20888990 AAATGACAAAAAAATTAACTGGG - Intronic
1106236532 13:27865925-27865947 AAATACCAAAATAATTATCTAGG + Intergenic
1106728940 13:32519012-32519034 AAATGCCAATTTATTTATCTTGG + Intronic
1107711504 13:43154802-43154824 AAATGCCAATATCATTAACATGG + Intergenic
1110015539 13:70396576-70396598 AAATGCCAAGTGAATGAAATAGG - Intergenic
1111108767 13:83679839-83679861 TAAGGCCAAATTAATTAATTTGG - Intergenic
1114870784 14:26655559-26655581 AAATGCCTAAATTATTAACTAGG - Intergenic
1115249680 14:31331996-31332018 AAATGCAAACTTAAGTATTTAGG + Intronic
1116061910 14:39934280-39934302 AAGTGCCAGCTTAATAAAATAGG - Intergenic
1118436832 14:65779214-65779236 AACTGCCAAATTATTTAAATCGG + Intergenic
1118534689 14:66747876-66747898 AAATGCCAAATTATTTACTTAGG + Intronic
1118979876 14:70707644-70707666 AGATGGCAAGTTTATTAACTGGG - Intergenic
1125988571 15:44081231-44081253 TTATGTAAACTTAATTAACTAGG - Intronic
1126735602 15:51729238-51729260 AAATTCCAAATTCCTTAACTTGG - Intronic
1130039768 15:80396388-80396410 AAATGCCAAGTGAATTAATAGGG - Intronic
1130339217 15:82985234-82985256 AAAGGTCAAGTTTATTAACTTGG - Intronic
1130725379 15:86433423-86433445 AAATGCCAACGTAATTTCCAGGG - Intronic
1130817863 15:87459180-87459202 AAATACCAACTTTAGTAAATTGG - Intergenic
1131205562 15:90442809-90442831 AAATACCAAAAAAATTAACTGGG + Intronic
1131537223 15:93247600-93247622 AAATGCCGACCTAAGTAACACGG + Intergenic
1132178789 15:99735790-99735812 AAATGACAAGTAAATGAACTAGG - Intergenic
1132316035 15:100891290-100891312 CAAGGCCCACTTACTTAACTAGG + Intronic
1132762156 16:1514207-1514229 AAATGCAAAAAAAATTAACTGGG + Intronic
1133438965 16:5804678-5804700 AAAGGCCACCGTAATTAATTAGG - Intergenic
1134816776 16:17212344-17212366 AAATTCTAACTTAATTAGTTTGG + Intronic
1138682162 16:58692853-58692875 TAATACCAATTTAATTCACTTGG + Intergenic
1139232011 16:65292535-65292557 TAATCCCAACTTAAATAAATGGG - Intergenic
1140971376 16:80016317-80016339 AATTCCCAACTTGAATAACTTGG - Intergenic
1143856256 17:9852515-9852537 AACTGCCATCTTAAGAAACTAGG + Intronic
1144329510 17:14211608-14211630 AGAATCCAACTTAATTTACTGGG - Intergenic
1145011285 17:19369745-19369767 AAATTCCAACTTAAAACACTGGG + Intronic
1146959580 17:36962284-36962306 AAATGCCTAATTAACTAAGTTGG - Intronic
1147793922 17:43029428-43029450 AATTGCCCACTTCATTAACTAGG - Intergenic
1148647274 17:49226213-49226235 CAATCCCATCTCAATTAACTGGG - Intronic
1149966723 17:61172246-61172268 AAATGTCAACTAGATTAAGTTGG - Intronic
1150065395 17:62104902-62104924 AAATGCCTACAAAATTAGCTGGG - Intergenic
1151147045 17:72050806-72050828 AAATACCAAAAAAATTAACTGGG + Intergenic
1151877282 17:76873950-76873972 AGATGACAACCTATTTAACTTGG - Intronic
1153609385 18:6867597-6867619 AAATACCAAATTAATTAAGAGGG + Intronic
1153933649 18:9901434-9901456 AAATGCGAACTCAAGTATCTAGG + Intergenic
1153935981 18:9922320-9922342 AAATGCAAACTCAAGTATCTAGG - Intronic
1155959699 18:31983676-31983698 AAAAGCCAGCTTTATAAACTGGG + Intergenic
1156877544 18:42033364-42033386 AAAAGGAAACTTAATTCACTTGG - Intronic
1156907270 18:42369040-42369062 ATATTACAACTAAATTAACTTGG - Intergenic
1157506880 18:48232722-48232744 AAAGCCCTACTGAATTAACTAGG - Intronic
1157871913 18:51237748-51237770 AAATACCAAAAAAATTAACTGGG - Intergenic
1159032923 18:63249547-63249569 AAATGCCAAAAAAATTAGCTGGG + Intronic
1160252548 18:77215877-77215899 AAATGCCAAGATAATTCAATGGG - Intergenic
1164874899 19:31677314-31677336 AAATGCCCACTTGACTAAATGGG + Intergenic
925905661 2:8538446-8538468 AAATGTTAACTTCATTAATTTGG + Intergenic
927014560 2:18944958-18944980 AAATGCAAAATTGATTAAATTGG - Intergenic
928069129 2:28197002-28197024 AAATACCAAAAAAATTAACTAGG - Intronic
929975472 2:46630076-46630098 AAATACAAACTTAAGTAATTGGG - Intergenic
931305906 2:61028295-61028317 AAATGCAATCTTAATTTAATAGG + Intronic
932338455 2:70944152-70944174 CAATGCCAACTAAATTTTCTAGG + Intronic
933518985 2:83347159-83347181 AAATGTCAGCTTTATGAACTTGG + Intergenic
934858683 2:97745479-97745501 AATATCCAACTCAATTAACTGGG + Intergenic
935544294 2:104384526-104384548 AAATGCCACCTGAATTCAGTTGG - Intergenic
936665126 2:114586088-114586110 AAATACAAAATTAATTAGCTGGG + Intronic
937779017 2:125815766-125815788 AAATGCAAACTTAAGTAAACTGG + Intergenic
938276435 2:130029227-130029249 AAATGCCAATTTTTTTAAGTAGG - Intergenic
938689725 2:133776620-133776642 AAATGCCAAGTTAAATTACAAGG + Intergenic
939240513 2:139552785-139552807 TTATGCCAACTTGATTAACCTGG - Intergenic
941491195 2:166144121-166144143 AAGTTGCTACTTAATTAACTAGG + Intergenic
941531316 2:166674905-166674927 AAAAGCCAGCTTAATTAGCCAGG - Intergenic
941773333 2:169365145-169365167 AAATTGCAACTGAATTAACCTGG - Intergenic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
943904576 2:193481577-193481599 TCATGACAACTAAATTAACTTGG - Intergenic
944651989 2:201839588-201839610 AAATACCAACATAATTATTTAGG + Intronic
947134349 2:226962218-226962240 AAATAGCAAATTCATTAACTAGG + Intronic
947685026 2:232076098-232076120 AAATGCCAACTTAATGAGTTGGG - Intronic
1173874754 20:46363481-46363503 AAATGCCAGCATAATACACTTGG + Intronic
1174073625 20:47916447-47916469 AAATTCTAACTTATTTAGCTTGG - Intergenic
1174704003 20:52637249-52637271 AAAGGCCAAATTCCTTAACTTGG - Intergenic
1177213385 21:18097943-18097965 ACATGCCAAGAAAATTAACTGGG + Intronic
1177532667 21:22382188-22382210 AAATGCCTACTAAATTACATTGG - Intergenic
1180242494 21:46519747-46519769 AAATCCCTATTTAATTTACTTGG - Intronic
1181614363 22:24042603-24042625 AAATTCTAAGTTAAATAACTTGG + Intronic
1181927902 22:26375230-26375252 AAATCCCAAATTCAGTAACTGGG - Intronic
1184145936 22:42610571-42610593 ACATGTCAACTGACTTAACTGGG + Intronic
1185007894 22:48295126-48295148 AAATGCCAATTAAATCAAGTTGG - Intergenic
949345643 3:3074018-3074040 AAATGCCAAGGCAATTCACTGGG + Intronic
952256865 3:31703190-31703212 AACAGGCAACTTAATAAACTGGG + Intronic
952879851 3:37977039-37977061 AAATTCAAACTCAATTAATTTGG + Intronic
954445994 3:50547216-50547238 AATTGCCAAATTAATCACCTGGG + Intergenic
955811976 3:62800485-62800507 AAATGAAAACTAAATTTACTGGG + Intronic
956166006 3:66398736-66398758 AAATACCAACTGAATTAACTGGG + Intronic
957228782 3:77484123-77484145 AAATAACATCCTAATTAACTGGG + Intronic
958017634 3:87960122-87960144 AAATTCCAATTTAATTGATTGGG - Intergenic
958568595 3:95849368-95849390 AAATGCGAAATAAATTAGCTGGG - Intergenic
958906305 3:99945690-99945712 AAATGCCAAAATAATTGTCTGGG - Intronic
961122661 3:124385970-124385992 AAAATTCAACTTAATTAAGTAGG - Intronic
961140827 3:124554302-124554324 AAACCCCAACTTAATTCACAGGG - Intronic
961605164 3:128088278-128088300 AAAAACCAACTTATTTATCTTGG + Intronic
961957712 3:130821341-130821363 AAACTCCATCTTAGTTAACTAGG + Intergenic
963242344 3:143019546-143019568 AAGTGCCAACATAATTTAATAGG - Intronic
964097728 3:152952475-152952497 AAATGCCATGTAAATTACCTGGG - Intergenic
964985684 3:162734431-162734453 GAATGCCACCTTGATTGACTAGG + Intergenic
965087922 3:164123782-164123804 AAATGCCATTGTAATTGACTAGG + Intergenic
965328555 3:167339612-167339634 AATTGCCCACCTAATTAACAGGG - Intronic
965570005 3:170162909-170162931 AAAGGCCACCTTTATTAACAAGG + Intronic
966257458 3:177933622-177933644 AAGTGGCAGCTGAATTAACTTGG + Intergenic
968114232 3:196077261-196077283 ACATGACAACTAAATTAAGTGGG + Intronic
968344452 3:197989493-197989515 AAATGCCATATTAATTTAGTGGG - Intronic
970929290 4:21490870-21490892 AAATTCCAAGTTAAGCAACTTGG - Intronic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
972419498 4:38873281-38873303 ACATTCTAACTCAATTAACTGGG + Intronic
974043774 4:56880144-56880166 AAATCCCATCTCAGTTAACTAGG + Intergenic
974585511 4:63870827-63870849 AAATTCCAAATAAATAAACTTGG + Intergenic
975466470 4:74714814-74714836 AACTGCCAGCTTAAGTAATTGGG + Intergenic
978938307 4:114406245-114406267 AAAAGCTAATTTAATCAACTTGG - Intergenic
979563487 4:122127099-122127121 AAATGTCAGCTGAATTTACTGGG + Intergenic
979781470 4:124656304-124656326 AAATGCCAAAGTAATTCAATGGG + Intergenic
979935838 4:126694077-126694099 AAAAGCCAAGTTAATAAAGTGGG - Intergenic
979939424 4:126741470-126741492 AAATGCCAACTTATTACCCTAGG + Intergenic
980012338 4:127610811-127610833 AAATGCAAAATAAATTAGCTGGG + Intergenic
980431239 4:132699227-132699249 AAATGCCAAAACAATTAAATGGG + Intergenic
980772349 4:137392791-137392813 AAATGCCAATTTCAGTTACTTGG + Intergenic
981289256 4:143055226-143055248 AAATGCCTACTTAAACAAGTGGG - Intergenic
981433060 4:144684895-144684917 AAATCCTAACTTCATTATCTTGG + Intronic
982068284 4:151673350-151673372 AAATGTCACCTCAATTAATTCGG - Intronic
983176126 4:164589823-164589845 TAATGCTAACTTGATGAACTTGG + Intergenic
984660282 4:182366516-182366538 AAATGTCATTTAAATTAACTAGG + Intronic
984997896 4:185453973-185453995 AAATACAAAATTAATTAGCTGGG - Intronic
986186908 5:5451372-5451394 AAATGCAAACTTAATGAAATAGG + Intronic
986260779 5:6144216-6144238 AAAAGCTAACTGAATTTACTAGG - Intergenic
986760195 5:10873050-10873072 AAATGCCAAGATAATTAAAAAGG - Intergenic
987560842 5:19518273-19518295 AAATGTTAAATTAATTAAGTAGG + Intronic
988017509 5:25578180-25578202 GAATAGCAACTTAATTAAATTGG - Intergenic
988084796 5:26461151-26461173 ATATGCCAATATAATTAACCAGG + Intergenic
988822697 5:34903270-34903292 AGGTGCCAACTTATTTTACTAGG - Intergenic
989636399 5:43540452-43540474 AAATACCTACATAATTGACTAGG + Intronic
992877557 5:81072574-81072596 AAATTATAACATAATTAACTAGG - Intronic
993249578 5:85501661-85501683 AAATGCCAAATTATTTACATAGG - Intergenic
993384615 5:87249920-87249942 TAATGACAAATTAATTAAGTGGG - Intergenic
993491416 5:88555873-88555895 AAATGTCAAGTTAATTTACAGGG - Intergenic
993805876 5:92408376-92408398 AAATGCCAACTAGATTGGCTTGG - Intergenic
994614388 5:102085502-102085524 AAATGCCAAGTTATTTAGTTTGG + Intergenic
996363798 5:122678591-122678613 AAATACCAAATAAATTAGCTGGG + Intergenic
997437653 5:133886617-133886639 AAATCCCACATCAATTAACTAGG + Intergenic
997489020 5:134257049-134257071 AAATACAAACAAAATTAACTGGG + Intergenic
997980071 5:138463611-138463633 AAAAACCAACTTAATGAACCAGG - Intergenic
998354508 5:141523842-141523864 AAATGCCAACTCAAATCCCTGGG + Intronic
998459727 5:142300974-142300996 AAATGCCAAAAAAATTAACCAGG - Intergenic
998881401 5:146648927-146648949 ATAGGCCAAGTTAAATAACTTGG + Intronic
998881402 5:146648932-146648954 AAAATCCAAGTTATTTAACTTGG - Intronic
999075569 5:148792308-148792330 AAATGCTAACCCAATGAACTGGG + Intergenic
999474235 5:151883775-151883797 GAAAGCCAACTTAAATACCTTGG + Intronic
1000217609 5:159177828-159177850 AAATGCCAATTTAAAAAATTTGG - Intronic
1003500399 6:6698180-6698202 AAATGCCAACAAATTTAGCTGGG + Intergenic
1005039866 6:21591736-21591758 AAAAGCCGACTTAATTATTTTGG + Intergenic
1006362609 6:33595192-33595214 AAAAGCCAACTTAAGCAGCTTGG + Intergenic
1009245560 6:61232470-61232492 AAATACCACCTTGATGAACTTGG - Intergenic
1009667513 6:66703414-66703436 ATAGGCCAATTTAATTTACTTGG - Intergenic
1010248867 6:73687639-73687661 AACTGCAAACTTAATTATGTGGG - Intergenic
1010375977 6:75170857-75170879 AAATGTCAACTGAATACACTTGG + Intronic
1010409833 6:75548567-75548589 ATATGTTAATTTAATTAACTAGG - Intergenic
1011009373 6:82686427-82686449 AAATAGCAAGTTATTTAACTTGG - Intergenic
1011575481 6:88792995-88793017 AAATAACCACTGAATTAACTAGG + Intronic
1011680102 6:89774850-89774872 AAAAGCCAACTCAACTATCTGGG - Intronic
1011897019 6:92240842-92240864 AAATGCTAACGTTCTTAACTAGG + Intergenic
1012087321 6:94845172-94845194 AAATGCCAAATCAATTATTTTGG - Intergenic
1012245316 6:96919884-96919906 AAATGCCTACTTAGTTGAATGGG - Intergenic
1012405876 6:98897549-98897571 TAATGCCATCTTAATTCATTCGG + Intronic
1013875720 6:114825212-114825234 AAATACAAAATTAATTACCTTGG + Intergenic
1014058699 6:117045971-117045993 AAATGTCAATTTGATCAACTTGG + Intergenic
1014599782 6:123396564-123396586 AAATGTCAGCATAATTCACTTGG + Intronic
1014613736 6:123576984-123577006 AAATGCCAACTTCATAAGGTAGG + Intronic
1014732583 6:125051010-125051032 AAATGCTAACATAATTTAGTAGG - Intronic
1014990489 6:128069170-128069192 AAATGGGAGCTTAAATAACTAGG - Intronic
1016134017 6:140516261-140516283 AAATGCAAATTTAATATACTTGG + Intergenic
1016421705 6:143891952-143891974 AGATGCCAAGGTAATTCACTGGG + Intronic
1016697521 6:147015391-147015413 AAATGCCAATTTAATTAGTTTGG - Intergenic
1017246868 6:152236185-152236207 GAAAGCCAACTAAATCAACTTGG - Exonic
1020444991 7:8259665-8259687 AAATGGTGACTTAAGTAACTTGG + Intronic
1020649026 7:10852815-10852837 AAATTATAACTTAATAAACTTGG + Intergenic
1021236677 7:18150909-18150931 AACTGGCAATTTAAATAACTAGG + Intronic
1021404825 7:20252897-20252919 AAATGCCAAAATAAATAAATGGG + Intergenic
1022399246 7:30021361-30021383 AAATGCCATTTTAAATAACTGGG + Intronic
1024465577 7:49708939-49708961 TAATGTCAACTTAATTATCCAGG - Intergenic
1026275260 7:68870754-68870776 AAATTCCAACTTCCTTAACAGGG - Intergenic
1027968301 7:85042107-85042129 AAATGCCAAGTTACTTAATTAGG + Intronic
1028082573 7:86597401-86597423 AATTGCCAACTTTATTCTCTTGG - Intergenic
1028215260 7:88124112-88124134 AAATGCCAACTTAGTTAAATTGG + Intronic
1028658646 7:93240144-93240166 AAATGCAAACTTGATAAATTTGG + Intronic
1028974829 7:96901094-96901116 AATTGCAAAATTAATAAACTAGG - Intergenic
1031362544 7:120864350-120864372 ATATGTTGACTTAATTAACTAGG + Intergenic
1031397238 7:121287734-121287756 GAATGGCATTTTAATTAACTCGG + Intronic
1031581592 7:123481661-123481683 AAACCCCAACTTAAGCAACTTGG + Intronic
1033060598 7:138102738-138102760 AAATGCCAACGCAATTCAATGGG + Intronic
1033456007 7:141504193-141504215 AAATTCCAATTAAATGAACTGGG + Intergenic
1034231431 7:149531632-149531654 AAATGCCAAAAAAATTAGCTGGG + Intergenic
1034388153 7:150758065-150758087 TAATGACAACTTAGTTATCTTGG - Intergenic
1035837212 8:2767387-2767409 AAATGCCATCTAAATTCTCTGGG - Intergenic
1036101773 8:5795085-5795107 AAATGCCAACTAGAGGAACTGGG + Intergenic
1039338941 8:36625506-36625528 AAATGTCAAATTAATTTTCTAGG + Intergenic
1039910584 8:41823852-41823874 AAATGCCAAGTTAATAATATTGG - Intronic
1042109493 8:65366172-65366194 AAATTCCATCTTAATAAAGTTGG + Intergenic
1044377848 8:91497476-91497498 AAATGCCCACTTCATAAAGTGGG - Intergenic
1045762328 8:105625442-105625464 AAATGGCCACTGAATTAAATTGG - Intronic
1045827105 8:106411329-106411351 AAAGGCCAACATATTTAACTTGG - Intronic
1046465015 8:114589927-114589949 GAATCCCAGCTTAATTAATTAGG - Intergenic
1047069338 8:121325404-121325426 AAATTCCAAATTATTTAACATGG - Intergenic
1052044675 9:23780396-23780418 AATTTCCAACTTAATAAACTTGG + Intronic
1052158074 9:25219719-25219741 GAATGCAAACATAATTTACTTGG - Intergenic
1052612595 9:30795165-30795187 AAATATCAACTTAATGACCTTGG - Intergenic
1053035061 9:34819341-34819363 AGATTCCACCTTAATAAACTAGG - Intergenic
1056695812 9:88850841-88850863 AAATGCCAACAAACTTAAGTGGG - Intergenic
1056788462 9:89610032-89610054 AAATGCCAGCTGAATTAATGAGG - Intergenic
1057373965 9:94501460-94501482 AAATGCCATATTAATTTAGTGGG - Intergenic
1058929590 9:109705658-109705680 AAATACCACCTTCCTTAACTGGG - Intronic
1059636407 9:116175417-116175439 TAATGCATACTTAATTAACTTGG + Intronic
1060414054 9:123418492-123418514 GAATAGCAACTTAATTACCTGGG + Intronic
1186420435 X:9421079-9421101 TAATGGCAACATAATTAAGTGGG - Intergenic
1187702874 X:21980847-21980869 AAATGCTAACTCATTTAAATAGG + Intronic
1188378504 X:29462986-29463008 AAATACCATCTTAATTCACATGG - Intronic
1188585788 X:31773406-31773428 AAATGCCAACTTTAAGATCTAGG + Intronic
1188640997 X:32504464-32504486 AAATACAAACATAATTATCTGGG + Intronic
1189455928 X:41190047-41190069 ATATGGTAACTTTATTAACTTGG + Intronic
1189588116 X:42482070-42482092 AAATGCCAACTAAATGATATTGG - Intergenic
1191899319 X:66024339-66024361 AAATGCCAGGTTAAATAATTTGG - Intronic
1193214198 X:78843169-78843191 AAATGTCAAGTTAATTATATTGG + Intergenic
1195393272 X:104385220-104385242 AAATGCCAAAATAATTAATCTGG - Intergenic
1197091229 X:122539928-122539950 AACTGCCAATATAATTCACTGGG + Intergenic
1197436546 X:126435477-126435499 ATATGCCATGTTCATTAACTGGG + Intergenic
1197499567 X:127227286-127227308 AAATGCAAACTTAATGTAATAGG - Intergenic
1199141282 X:144316538-144316560 AAATGCCAAGATAATTTAATGGG + Intergenic
1201522535 Y:14891860-14891882 AAATGCCAATTAAATAAATTTGG + Intergenic
1202074156 Y:21021763-21021785 AAAAGCCATCTTAATTTACAGGG - Intergenic