ID: 1064741529

View in Genome Browser
Species Human (GRCh38)
Location 10:18439595-18439617
Sequence ATTTCAAAGGTGATAGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064741529_1064741535 19 Left 1064741529 10:18439595-18439617 CCTCCCGCTATCACCTTTGAAAT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1064741535 10:18439637-18439659 CATATTATCACACTGTAAATTGG No data
1064741529_1064741536 20 Left 1064741529 10:18439595-18439617 CCTCCCGCTATCACCTTTGAAAT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1064741536 10:18439638-18439660 ATATTATCACACTGTAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064741529 Original CRISPR ATTTCAAAGGTGATAGCGGG AGG (reversed) Intronic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
905939719 1:41853541-41853563 ATGTCAAAGGAGAGAGCAGGTGG - Intronic
909965008 1:81898385-81898407 ATTTCAAAGGTGACAGTAGTAGG + Intronic
1064741529 10:18439595-18439617 ATTTCAAAGGTGATAGCGGGAGG - Intronic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1070491713 10:76982732-76982754 AGTTCAAAGAGGATAGTGGGTGG + Intronic
1072845081 10:98820441-98820463 ATTACAAAGGAGATAGGGGCTGG + Intronic
1073531131 10:104232674-104232696 CTTTCGAAGGTCAGAGCGGGAGG + Intergenic
1075351490 10:121728843-121728865 ATTTCCAAGGTGGTTGTGGGGGG + Intergenic
1082688086 11:56264392-56264414 ATTTCACTGGGGATAGTGGGTGG - Intergenic
1083071040 11:59981778-59981800 ATTTCAAAGGTCACATTGGGTGG + Intergenic
1085938611 11:81180846-81180868 ATTTCAAAGTTTATAGGGAGAGG - Intergenic
1087297056 11:96389830-96389852 CTTTGAAAGGTGAGAGCGCGAGG - Intronic
1089413565 11:118267444-118267466 TTTTCAAAGATGAGAGAGGGAGG + Intergenic
1092308142 12:7322768-7322790 ATCTCAGAGGCGTTAGCGGGTGG + Intronic
1093624845 12:21332816-21332838 ATTTCTAAGGTGATGGCAGTAGG - Intronic
1096103759 12:48984934-48984956 ATTTCAAAGGTGATGGTGCTGGG + Intergenic
1102426718 12:112849566-112849588 ATATAAAATGTGATAGCTGGTGG - Intronic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1104630265 12:130394779-130394801 ATTTGAAAAGTGTTAGCGAGAGG + Intergenic
1111996996 13:95175261-95175283 ATTTCTAAGGTGCTAGGGTGAGG - Intronic
1118202310 14:63687702-63687724 ATTTCAAAAGTGATAGGAGCTGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1121648879 14:95541079-95541101 ATTTCATATGTGATAGACGGTGG - Intronic
1127146752 15:56032831-56032853 ATTTCAAAGGTTAAAATGGGCGG - Intergenic
1127239670 15:57098861-57098883 ATTTGCAAGGTGAAAGAGGGAGG - Intronic
1131100152 15:89682001-89682023 ATTTCTAGGGTGATTGAGGGAGG - Exonic
1149368392 17:55968150-55968172 TTTTCAAAGCTGATAGTTGGTGG - Intergenic
1150998722 17:70349453-70349475 ATTTCAAAGGTCAGAGTGGGAGG - Intergenic
1151435303 17:74092032-74092054 ATTTCACAGCTCATAGCCGGAGG - Intergenic
1153101026 18:1469793-1469815 ATTTCAAATATGATAGAGTGTGG - Intergenic
1155140657 18:23041522-23041544 ATTTAACAGGTCATAGGGGGAGG - Intergenic
1156001940 18:32394863-32394885 ATTTCACAGGTGAAAGAAGGAGG - Intronic
1166498406 19:43323254-43323276 ATCTCACAGGTGAGAGCAGGAGG + Intergenic
1167284119 19:48589187-48589209 ATTTTGAAGGTGAGACCGGGAGG + Intronic
1168475406 19:56671587-56671609 CGTTCGAAGGTGATACCGGGAGG - Exonic
926630662 2:15133304-15133326 ATTTGGAAGGACATAGCGGGGGG + Intergenic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
936109462 2:109653098-109653120 ATTTCAAAGGTGACTGTGGCTGG + Intergenic
937715314 2:125025513-125025535 ATTTTAAAGGAGGTAGGGGGTGG - Intergenic
938508885 2:131918780-131918802 ATTTCAAAGGTATGAGAGGGGGG - Intergenic
942089352 2:172473912-172473934 ATTACGAATGTGATAGCTGGTGG + Intronic
942666935 2:178329740-178329762 ATTTCAAAGAGGATACTGGGTGG - Intronic
943658305 2:190532205-190532227 TTTTCAAAGGTGTTAACGTGAGG + Intronic
944212987 2:197225795-197225817 ACTTAAAAGGTGATATGGGGTGG + Intronic
944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG + Intronic
946944263 2:224803320-224803342 ATTTCAAAGGGCATGGAGGGAGG + Intronic
1176784605 21:13239764-13239786 ATTTCAAAGGTATGAGAGGGGGG + Intergenic
1177982652 21:27933608-27933630 ATTTCAAAGGTATGAGAGGGGGG + Intergenic
949918056 3:8980470-8980492 ATTTCAAAGGTGTTTCCTGGGGG + Intergenic
949995255 3:9611616-9611638 ATTACAAAGGTAATACTGGGTGG - Intergenic
952092702 3:29909084-29909106 ATTTCAAAGGGGACTACGGGGGG + Intronic
953128576 3:40115539-40115561 ATGTCAAAGGTGGGAGCAGGTGG - Intronic
957978066 3:87473226-87473248 ATGTCAAGGGTGAGAGCAGGTGG + Intergenic
959792848 3:110385342-110385364 TTTTCAAAGGTAAGAGTGGGAGG + Intergenic
961401660 3:126650657-126650679 GTTTCAAAGGTGATTTAGGGAGG - Intronic
965822849 3:172701920-172701942 AGTTCAAAGGTCAGAGAGGGAGG - Intronic
969294783 4:6263414-6263436 ATTTCGAAGGTGAGGGCTGGGGG + Intergenic
971075205 4:23140057-23140079 AATTCAAATGTGATAGCAGCAGG - Intergenic
974095908 4:57363709-57363731 ATTTTAAAGGAGATAGGGGTGGG - Intergenic
974702633 4:65471781-65471803 ATGTCAAAGGAGAGAGCAGGTGG - Intronic
974938411 4:68435030-68435052 ATTTCTAAACTGATAGCTGGCGG + Intergenic
984988106 4:185351102-185351124 ATTTCAAAAGTGGTAGCGCCTGG + Intronic
986755628 5:10833250-10833272 AGATCAAAGGAGATAGCGTGTGG + Intergenic
987650161 5:20730914-20730936 ATCTCAAAGGTGGTAGGTGGGGG + Intergenic
988745398 5:34130553-34130575 ATCTCAAAGGTGGTAGGTGGGGG - Intergenic
989397467 5:40973441-40973463 ATTTCACAGGTGATGGTGTGAGG + Intronic
989585041 5:43067834-43067856 ATTTCAAAGGTGATAGAAATCGG - Intronic
990339085 5:54804759-54804781 TTTTCAAAGCTGATAGGGGAAGG - Intergenic
990973225 5:61532996-61533018 TTTTCAAAGTTGATAGTGTGTGG + Intronic
992676964 5:79114654-79114676 ATTTCAAATGGGATTGGGGGTGG - Intronic
992836650 5:80648329-80648351 ATGTCAAGGGTGATACCAGGTGG + Intronic
999322512 5:150624364-150624386 ATTTCAAAGTGGGTAGTGGGTGG + Intronic
1003613002 6:7630219-7630241 ATTTCCAAGGTGATGGCATGAGG + Intergenic
1006519507 6:34563189-34563211 ATTTCAAAGGGGCTAATGGGTGG - Intergenic
1009615311 6:65998016-65998038 ATTTCAAAAGAGATAGCGGTGGG - Intergenic
1014602026 6:123425075-123425097 ATTTCAAAGGTGAAAGTGAGAGG + Intronic
1016428930 6:143963085-143963107 ATTTTAAAGGTGACACTGGGGGG + Intronic
1019068762 6:169324608-169324630 ATTTCCAAGGTGATAGCATCAGG - Intergenic
1024980708 7:55155513-55155535 ACTTTAAAGGTGAGAGCAGGTGG + Intronic
1034823831 7:154242147-154242169 ATTTCAAAGGTGCCAGTCGGGGG - Intronic
1039618112 8:38973103-38973125 ATTTCAAAAGTAATAGATGGTGG - Exonic
1047181840 8:122595865-122595887 TTTTCAAAGATGTTAGTGGGAGG - Intergenic
1048069559 8:131007303-131007325 ATTTCCAAGGTGAAAGAGGTAGG + Intronic
1049367470 8:142247504-142247526 ATTTCACAGCTCATAGTGGGGGG + Intronic
1049445593 8:142629269-142629291 ATGTCAAAGGTGATAGGTTGGGG - Intergenic
1053562237 9:39208568-39208590 GTTTGAAAGGTGATAGCGGCTGG + Intronic
1053828042 9:42046567-42046589 GTTTGAAAGGTGATAGCAGCTGG + Intronic
1054134881 9:61410390-61410412 GTTTGAAAGGTGATAGCGGCTGG - Intergenic
1054602515 9:67140879-67140901 GTTTGAAAGGTGATAGCAGCTGG - Intergenic