ID: 1064741974

View in Genome Browser
Species Human (GRCh38)
Location 10:18443258-18443280
Sequence GACACTAGGGTGTTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064741974_1064741978 -6 Left 1064741974 10:18443258-18443280 CCAGTGAGAAACACCCTAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1064741978 10:18443275-18443297 AGTGTCCTAACTGAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064741974 Original CRISPR GACACTAGGGTGTTTCTCAC TGG (reversed) Intronic
901033787 1:6324012-6324034 GGCACTGGGGTCTTTCTAACAGG - Intronic
906494747 1:46296699-46296721 GACACTAGGGTGTTCTGCAGGGG - Intronic
908560138 1:65298036-65298058 GACACTAGGGTTTTTTTTAAAGG - Intronic
912210827 1:107555019-107555041 GCCACAAGAGTGTTTGTCACGGG - Intergenic
913370023 1:118088041-118088063 GACAGTAGGGTGTTTCTACAAGG - Intronic
914893633 1:151650628-151650650 AATTCTTGGGTGTTTCTCACAGG + Intronic
917743162 1:177981424-177981446 GAAAGAAGGATGTTTCTCACTGG + Intronic
919327006 1:196120740-196120762 GCCAGTAGGGTGATTCTCATAGG + Intergenic
920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG + Intronic
924166289 1:241286652-241286674 CAAACTAGGGTTTTTCTCTCAGG + Intronic
1063245799 10:4217125-4217147 GAAACTAGGGTTTATCTTACAGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1076293111 10:129362727-129362749 CACCCTAGGCTGTTTCTCCCGGG - Intergenic
1076432231 10:130412451-130412473 GATTCTTGGGTGTTTCCCACAGG + Intergenic
1076759612 10:132595611-132595633 TACATTGGGGTGTTTGTCACTGG + Intronic
1077822958 11:5768501-5768523 GGCACTAGTATGTTTATCACAGG - Intronic
1087137036 11:94731394-94731416 GATACTAAGGTGGTTCTCAGAGG + Intronic
1099237926 12:80104250-80104272 GAGATTGGGATGTTTCTCACTGG - Intergenic
1102955239 12:117054636-117054658 GAAACTGGGGTGCTGCTCACGGG - Intronic
1105905413 13:24804964-24804986 GACAACAGTGTCTTTCTCACAGG - Intronic
1108497022 13:51035334-51035356 AATAAGAGGGTGTTTCTCACAGG - Intergenic
1111095634 13:83511461-83511483 CCCTCTAGGTTGTTTCTCACAGG + Intergenic
1113223012 13:108127109-108127131 GACACTGGTGTTGTTCTCACAGG - Intergenic
1124997178 15:34735230-34735252 GAGACTAGGGTGAATGTCACTGG + Intergenic
1126376070 15:47997730-47997752 GACAGTCAGGCGTTTCTCACAGG - Intergenic
1130714490 15:86318298-86318320 GCCACTAGTGTGTCTCTCCCAGG + Intronic
1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG + Intronic
1135930005 16:26728220-26728242 GAGACCAGGCTGTCTCTCACTGG - Intergenic
1140052023 16:71489700-71489722 GACACAAGGGTCTTCCTCAATGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144955942 17:19018865-19018887 GACACTAGGATTTTTCACACTGG - Intronic
1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG + Intergenic
1150098779 17:62403326-62403348 TACACTAGGGTGTTTCTGTGGGG - Intronic
1150639357 17:66939210-66939232 GCCACTGGGGTGAGTCTCACTGG - Intergenic
1151130674 17:71893446-71893468 CACATTAGGAAGTTTCTCACTGG + Intergenic
1162617005 19:11810128-11810150 GACTCTAGGGGGTTTCAAACAGG - Intergenic
1164608449 19:29616540-29616562 TCCACTACGGTGTTTCTCTCTGG - Intronic
939533426 2:143393772-143393794 GACATTAAGGTGTCTTTCACAGG + Intronic
1171289553 20:23974165-23974187 GCCACTAAGGTCTTCCTCACAGG - Intergenic
1171520090 20:25769157-25769179 GACACTAGGGTGATTCAGACAGG + Intronic
1171556829 20:26087336-26087358 GACACTAGGGTGATTCAGACAGG - Intergenic
1175400380 20:58696824-58696846 GACAACAGGATGTATCTCACAGG - Intronic
1176654222 21:9575433-9575455 GACACTAGGGTGATTCAGACAGG + Intergenic
1178641802 21:34350773-34350795 GGCACTAGGGAGTTTCTTAAGGG + Intergenic
1180071035 21:45435916-45435938 GACCCCAGGGTGCATCTCACAGG - Intronic
1180762899 22:18222844-18222866 GACACTGGGGGGTTTCTTCCTGG - Intergenic
1180772746 22:18401703-18401725 GACACTGGGGGGTTTCTTCCTGG + Intergenic
1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG + Intergenic
1180806649 22:18718158-18718180 GACACTGGGGGGTTTCTTCCTGG - Intergenic
1181025893 22:20127482-20127504 GACACCAGGGCGTCTCTCCCAGG - Intergenic
1181217594 22:21343940-21343962 GACACTGGGGGGTTTCTTCCTGG - Intergenic
1182579244 22:31294498-31294520 GACTCTAGGGTGTAATTCACAGG - Intergenic
1184549052 22:45194668-45194690 GACAGTAAGGTGTTACTCCCAGG - Intronic
1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG + Intergenic
951806914 3:26655372-26655394 GACATTATGGTGCCTCTCACAGG - Intronic
955084454 3:55689052-55689074 CACACTGGGGTGTCTCTCAAGGG + Intronic
965191608 3:165537595-165537617 GACTCTAGGCTATTTCTAACTGG - Intergenic
977481638 4:97585385-97585407 GCCACCTTGGTGTTTCTCACTGG - Intronic
982529833 4:156525668-156525690 AACACAAGGCTGTTTTTCACAGG + Intergenic
985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG + Intronic
986625659 5:9721467-9721489 GACACCAGGGACTTTCACACAGG - Intergenic
989201634 5:38770007-38770029 GACACTAGGGCTCTTCTCACGGG - Intergenic
989232415 5:39101523-39101545 GCCAATATGATGTTTCTCACAGG + Intergenic
992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG + Intergenic
997884027 5:137614893-137614915 GACACTGGGGTCTTTCCCAGAGG + Intergenic
1006205594 6:32339039-32339061 GACTCAAGGGTGTTTATCTCAGG + Intronic
1011859469 6:91737206-91737228 GACTCCATGGAGTTTCTCACTGG + Intergenic
1015327236 6:131937056-131937078 GACAATGGGGTGTTTCTATCTGG + Intergenic
1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG + Intronic
1018235395 6:161718609-161718631 GCCACTGGGCTGTTTCTCTCGGG - Intronic
1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG + Intronic
1022552568 7:31255163-31255185 GTCTCTAGGGGGTTTCTCTCTGG - Intergenic
1023002809 7:35828960-35828982 GACACTAGAGAGTTTTTCATAGG - Intronic
1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG + Intronic
1025280573 7:57624101-57624123 GACACTAGGGTGATTCAGACAGG + Intergenic
1025304157 7:57841406-57841428 GACACTAGGGTGATTCAGACAGG - Intergenic
1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG + Intronic
1035195348 7:157214946-157214968 GACTCTATGGTGTTGCTCAGGGG - Intronic
1036012550 8:4743469-4743491 GACGCTCCGGTGTTTCTGACCGG - Intronic
1037299387 8:17435089-17435111 CACCCTTGGGGGTTTCTCACTGG + Intergenic
1038355596 8:26826249-26826271 GATAGTTGGGTGTTTCTGACTGG + Intronic
1039816336 8:41097874-41097896 CTCACTGGGATGTTTCTCACTGG - Intergenic
1048966948 8:139622119-139622141 CACACCATAGTGTTTCTCACTGG + Intronic
1051093521 9:13438013-13438035 GACACAAGTGTGTTTGTGACTGG - Intergenic
1062411093 9:136424920-136424942 AACACTAGGATGTTTCTAACAGG - Intergenic
1203631943 Un_KI270750v1:78891-78913 GACACTAGGGTGATTCAGACAGG + Intergenic
1186557300 X:10573426-10573448 GAGACTAGATTGGTTCTCACAGG - Intronic
1186629949 X:11338020-11338042 GACACTAGATTGGTTCTCAGGGG - Intronic
1190577648 X:51856975-51856997 GACACTGGGGAGGTTCTCATGGG + Intronic
1199121413 X:144058754-144058776 TACACATGTGTGTTTCTCACTGG + Intergenic
1199460399 X:148077492-148077514 GACAGTAAGGTGATTCTGACAGG - Intergenic