ID: 1064741978

View in Genome Browser
Species Human (GRCh38)
Location 10:18443275-18443297
Sequence AGTGTCCTAACTGAAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064741974_1064741978 -6 Left 1064741974 10:18443258-18443280 CCAGTGAGAAACACCCTAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1064741978 10:18443275-18443297 AGTGTCCTAACTGAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064741978 Original CRISPR AGTGTCCTAACTGAAGGAAG AGG Intronic
No off target data available for this crispr