ID: 1064744021

View in Genome Browser
Species Human (GRCh38)
Location 10:18461547-18461569
Sequence ATTTTTCCACAGGTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064744009_1064744021 19 Left 1064744009 10:18461505-18461527 CCCAACCTTTTTGGCACCAGGGA 0: 956
1: 1606
2: 1390
3: 917
4: 585
Right 1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG No data
1064744011_1064744021 14 Left 1064744011 10:18461510-18461532 CCTTTTTGGCACCAGGGAACGAG 0: 1
1: 0
2: 19
3: 339
4: 1563
Right 1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG No data
1064744010_1064744021 18 Left 1064744010 10:18461506-18461528 CCAACCTTTTTGGCACCAGGGAA 0: 16
1: 1042
2: 1736
3: 1450
4: 1017
Right 1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG No data
1064744013_1064744021 3 Left 1064744013 10:18461521-18461543 CCAGGGAACGAGTTTCCTGGAAG 0: 1
1: 0
2: 1
3: 15
4: 147
Right 1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG No data
1064744007_1064744021 20 Left 1064744007 10:18461504-18461526 CCCCAACCTTTTTGGCACCAGGG 0: 949
1: 1567
2: 1323
3: 855
4: 618
Right 1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG No data
1064744004_1064744021 28 Left 1064744004 10:18461496-18461518 CCAGTGGTCCCCAACCTTTTTGG 0: 77
1: 171
2: 242
3: 326
4: 370
Right 1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064744021 Original CRISPR ATTTTTCCACAGGTGGGGAG GGG Intronic
No off target data available for this crispr