ID: 1064751048

View in Genome Browser
Species Human (GRCh38)
Location 10:18529398-18529420
Sequence CTCTTCACTGATTCGCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064751048_1064751050 -6 Left 1064751048 10:18529398-18529420 CCATAAGGCGAATCAGTGAAGAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1064751050 10:18529415-18529437 GAAGAGCCCTTTGAGATAGAGGG No data
1064751048_1064751054 25 Left 1064751048 10:18529398-18529420 CCATAAGGCGAATCAGTGAAGAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1064751054 10:18529446-18529468 AAAGTGGTCGAGCCATGAACTGG No data
1064751048_1064751049 -7 Left 1064751048 10:18529398-18529420 CCATAAGGCGAATCAGTGAAGAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1064751049 10:18529414-18529436 TGAAGAGCCCTTTGAGATAGAGG No data
1064751048_1064751053 9 Left 1064751048 10:18529398-18529420 CCATAAGGCGAATCAGTGAAGAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1064751053 10:18529430-18529452 ATAGAGGGTGATGAGCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064751048 Original CRISPR CTCTTCACTGATTCGCCTTA TGG (reversed) Intronic
900852626 1:5156053-5156075 CTCTTCACTTTTTCACCTTGAGG - Intergenic
913437981 1:118866869-118866891 CTCCTCAAAGATTTGCCTTAAGG + Intergenic
915042497 1:152980877-152980899 CTGATCACTGATTAGACTTAGGG + Intergenic
922877554 1:228951777-228951799 CCCTTCACTGACTCTCCTTTTGG + Intergenic
1064751048 10:18529398-18529420 CTCTTCACTGATTCGCCTTATGG - Intronic
1065410949 10:25427401-25427423 CTCATCACTGAGTAGGCTTAAGG - Intronic
1066791639 10:39071219-39071241 CTCTTCACAGATTCTCCAAAAGG - Intergenic
1069192312 10:65506419-65506441 CTCTTCTGTGATTCACCTTTGGG + Intergenic
1072994075 10:100228008-100228030 CTCCTCATTAATTGGCCTTAAGG - Intronic
1085382187 11:76130054-76130076 CTCTTCACTCATTGACCTTTTGG + Intronic
1086986669 11:93258066-93258088 CTTTGAACTGATTCACCTTAGGG + Intergenic
1087355824 11:97092930-97092952 CTTTTCACTGATTTGCTTTTGGG - Intergenic
1089470577 11:118717120-118717142 CTCTTCACTGACTCTCTTTTTGG - Intergenic
1092723250 12:11462257-11462279 CCCTTCACTGACTCTCCTTTAGG - Intronic
1094130447 12:27069074-27069096 GTCTTCACTGACTCACCCTAGGG - Intergenic
1097080529 12:56427432-56427454 CTTTTCACTGATTCCACTTTGGG + Intronic
1098745612 12:74233926-74233948 ATCTTCACTGTTTCACCTCAAGG + Intergenic
1099188394 12:79540188-79540210 CCCTTCACTGATTCTCTTTTTGG + Intergenic
1100670601 12:96808236-96808258 CTCTGCACTGATTGCTCTTATGG + Intronic
1100762640 12:97826284-97826306 CTCTTCACTAAGTAGCCTTTGGG - Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103242278 12:119423550-119423572 CCCTTCTCTCATTCGGCTTATGG + Intronic
1110619185 13:77576555-77576577 CTCTTCTCTGAGTTGCCTTTGGG + Intronic
1111301683 13:86358507-86358529 CCCTTCACTGATTCTCTTTTGGG + Intergenic
1116665008 14:47763367-47763389 CTCTTCACTGATTCTTCTCATGG - Intergenic
1118691236 14:68342377-68342399 TTCTTCACTGTTCCTCCTTAGGG + Intronic
1122320364 14:100851781-100851803 CTCTTCTCTGACTCGCCCTCCGG + Intergenic
1130672185 15:85922425-85922447 CTGTTCACTGAGTCACCTTCAGG - Intergenic
1133244637 16:4439911-4439933 CTCTTTTCTGTTTGGCCTTAAGG + Intronic
1146147479 17:30433468-30433490 CTTTTCAATGATTCTCCTAAGGG + Intronic
1148513456 17:48193388-48193410 CTCTTGCCTGGTTCCCCTTATGG + Intronic
1155533516 18:26791889-26791911 CTCTTCACTGAGTGTCCTCATGG + Intergenic
929489274 2:42382109-42382131 CTCTTCACTCATTCACCCCACGG + Intronic
941075735 2:161004419-161004441 CTCTTCAGTGATTCTCTCTAAGG + Intergenic
945375275 2:209072606-209072628 CTCTTCAATGATGGGCCTTAAGG + Intergenic
945556530 2:211282903-211282925 ATCTTCACTGTTACTCCTTAGGG - Intergenic
946661151 2:222001120-222001142 CACTTTCCTGATTAGCCTTATGG + Intergenic
1169111810 20:3038917-3038939 GTCCTCACTGAGTCTCCTTAAGG + Intronic
1169287475 20:4321669-4321691 CTCTTCACTTATTCACCCCAAGG + Intergenic
949162412 3:896090-896112 CTCTTCACTGACTCTCTTTTTGG - Intergenic
949258619 3:2080146-2080168 CTCTTAACTCATTCCCCTTTTGG - Intergenic
951315549 3:21185792-21185814 CTCTTCACTGATTCTCTTTTCGG - Intergenic
951424851 3:22532434-22532456 CTGTTCTCTGAGACGCCTTATGG - Intergenic
951453651 3:22867019-22867041 CTCTGGACTAATTCACCTTAGGG + Intergenic
954519289 3:51209278-51209300 CTAATCACTGATTCTCATTATGG - Intronic
957457893 3:80476317-80476339 CTCTTCACTGTTTCACAGTATGG + Intergenic
961519029 3:127456259-127456281 CTCTTCACGGACTCTCCTTCAGG + Intergenic
963867174 3:150374953-150374975 CACCTGACTGATTTGCCTTAGGG - Intergenic
964291983 3:155191469-155191491 CTTTTCACTGTTTCCCCATATGG - Intergenic
965503125 3:169480045-169480067 TTCTACATTGATTCGCCTTTTGG + Intronic
970668028 4:18360471-18360493 CTCTCTACTGATTCCCCTGATGG - Intergenic
971232324 4:24809665-24809687 TTCTTCACTGTTTAGCCTGAGGG - Intronic
974874921 4:67692253-67692275 CTCTTCAGTGATTTTCCTTATGG - Intronic
977075507 4:92444292-92444314 CCCTTCACTGACTCTCTTTACGG - Intronic
978635921 4:110806876-110806898 CTCTTCAATGATTTTCCATATGG - Intergenic
978635992 4:110807801-110807823 CTCTTCAATGATTTTCCATATGG + Intergenic
981000745 4:139826281-139826303 CCCTTCACTGATACTCCTTGTGG - Intronic
985413718 4:189714759-189714781 CTCTTCACTAATTCTCCCAACGG - Intergenic
994076626 5:95658833-95658855 CTCCTCTCTGTTTTGCCTTATGG + Exonic
994407470 5:99363204-99363226 CTCAACACTGATTTGCCTTTAGG + Intergenic
999279101 5:150353171-150353193 CCCTTCACTGAATTGCCTCAGGG - Intergenic
1003631786 6:7794093-7794115 CTCTTCACTCTTGCTCCTTATGG + Intronic
1007842123 6:44725192-44725214 CTCTTCAGTGACTCGCATCATGG + Intergenic
1009343298 6:62586272-62586294 CTCTTCACTGACTCTCTTTTGGG + Intergenic
1016853750 6:148645400-148645422 CTCTTCACTGACTCTCTTTTCGG + Intergenic
1026227318 7:68453691-68453713 CTCTTCTCTGACTAGCCTGATGG + Intergenic
1031685557 7:124729445-124729467 CTCTTCACTGACTCTCTTTTCGG + Intergenic
1032258952 7:130319198-130319220 CTCTTCACTGATTCTGCTCCAGG + Intronic
1048649314 8:136456569-136456591 CTCTTCATTGTTTCTCCATATGG - Intergenic
1051312105 9:15786943-15786965 CCCTTCACTGATTCTCTTTTTGG + Intronic
1052571472 9:30229596-30229618 CTCTTCACTTATATGCCATATGG - Intergenic
1055769021 9:79696369-79696391 CGCTTAACTGATTGGTCTTAAGG - Intronic
1060770631 9:126329272-126329294 TTCTTGACTGATTAGCTTTATGG - Intronic
1193197492 X:78650802-78650824 CTCCTCACTGATTTTCCATAAGG - Intergenic
1196354512 X:114774837-114774859 CTCTTCAGTGATGGGCCTTGAGG + Intronic
1199799434 X:151234973-151234995 ATCTTCACTGATTAGCCTTGTGG + Intergenic