ID: 1064757397

View in Genome Browser
Species Human (GRCh38)
Location 10:18583652-18583674
Sequence ATTCTCTATTTGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064757397_1064757400 5 Left 1064757397 10:18583652-18583674 CCATGTTTCATCAAATAGAGAAT 0: 1
1: 1
2: 1
3: 31
4: 364
Right 1064757400 10:18583680-18583702 TAGAGGGAAATTTTTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064757397 Original CRISPR ATTCTCTATTTGATGAAACA TGG (reversed) Intronic
900499747 1:2997538-2997560 ATTCTCTACTTGGTGACACATGG + Intergenic
900725598 1:4214406-4214428 ATTCTTTTTTTGTTGAGACAAGG + Intergenic
902553340 1:17232245-17232267 CTACTTTATTTTATGAAACAGGG + Intronic
904018129 1:27440174-27440196 ATCCTAAATTTGATGAAATATGG - Intronic
906813436 1:48852573-48852595 ATTCTCTAATTTAGGAAAAAAGG - Intronic
907729599 1:57053230-57053252 ATTTTCGTTTTGATGAAACATGG - Intronic
907816209 1:57920488-57920510 ATTTTCTTTTTTTTGAAACAGGG + Intronic
908688079 1:66744916-66744938 ATTCTAAATTCCATGAAACATGG + Exonic
908900790 1:68954155-68954177 ATTCTCTAGTTGTTTAAACTTGG + Intergenic
909196479 1:72632625-72632647 ATTCTCTAATTGTTGAAATAGGG + Intergenic
909636809 1:77826231-77826253 AATTTGTATTTAATGAAACAAGG + Intronic
910017807 1:82548841-82548863 ATTCTTTATTTTATAAATCATGG - Intergenic
910340978 1:86186999-86187021 GTTTTCTCTTTGATGAAAAAAGG + Intergenic
910477956 1:87627140-87627162 ATTCTCAATTACAAGAAACAAGG + Intergenic
910520278 1:88113431-88113453 TTTCTCTATTTGAGGCAACAAGG + Intergenic
910857815 1:91713409-91713431 ATTCTCCATTTGGTGACACGTGG + Intronic
910990202 1:93048054-93048076 AATATTTATTTGATAAAACATGG + Intergenic
911133696 1:94417759-94417781 ATTCTCAATTTTATTAAAAACGG + Intergenic
911613115 1:99978517-99978539 ATTTTATATTTTTTGAAACAGGG - Intronic
911755003 1:101543964-101543986 CTTCTCTAATTGATGACACATGG - Intergenic
913240211 1:116823512-116823534 GTTTTCTATTTGATGAAATATGG + Intergenic
914457707 1:147851844-147851866 ATTCTCTACTTGAAGGAACCAGG + Intergenic
914767416 1:150650975-150650997 ATTCTCTATATGATAAGTCATGG - Intronic
915001385 1:152597086-152597108 CTTCACTATTTGATCAAACCTGG + Intronic
916210284 1:162354731-162354753 ATTCTGTAGTTAAAGAAACATGG + Intronic
916699279 1:167273974-167273996 AATCTCTATGTGAAAAAACAAGG + Intronic
916756309 1:167773428-167773450 CTTCTGTATTTAATGAAAAAAGG + Intronic
917838303 1:178958104-178958126 ATTTTTTATTTTCTGAAACAGGG + Intergenic
918028400 1:180777788-180777810 TTTCTATATTTGATGGAGCATGG + Intronic
919820854 1:201470941-201470963 GTTCTCTCTCTGAGGAAACAGGG + Intergenic
920955823 1:210619385-210619407 ACTCTCCATGTGATGACACATGG + Intronic
921376962 1:214484556-214484578 GTTCCATGTTTGATGAAACAAGG + Intronic
921405455 1:214774699-214774721 ATTTTCTCTTTTAGGAAACAGGG + Intergenic
922388130 1:225108787-225108809 ATTCTCTATTTTATTAGACTGGG - Intronic
922605208 1:226885874-226885896 ATTTTCTTTTTCTTGAAACATGG + Intronic
923235523 1:232029499-232029521 ATTGTATCTTTGATCAAACATGG - Intronic
924039883 1:239974021-239974043 ATTCACTCTTTGAAGAAACATGG + Intergenic
1063106463 10:2996816-2996838 TTTTTATATTTGATGAAAAAGGG + Intergenic
1064125515 10:12656485-12656507 TTTCTCTTTTTTTTGAAACAGGG - Intronic
1064735568 10:18378733-18378755 ATTTTCTATTTTTTGAGACAGGG - Intronic
1064757397 10:18583652-18583674 ATTCTCTATTTGATGAAACATGG - Intronic
1064918917 10:20494132-20494154 ATTCTCTGTTAGATGTAAAAAGG - Intergenic
1065095042 10:22272083-22272105 ATGCTCTTTTTATTGAAACAGGG + Intergenic
1066077849 10:31898115-31898137 ATTCTGTAGTTGTTGAGACAAGG - Intronic
1066501615 10:36000491-36000513 ATTCTCTATCTGCTGTAACTTGG + Intergenic
1066704249 10:38160228-38160250 ATTCTCCAGTTAATGAACCAGGG - Intergenic
1068072283 10:52210112-52210134 AATCCCTATTTGATGAACTAGGG + Intronic
1068197259 10:53732942-53732964 ATTATTTATTTATTGAAACAAGG + Intergenic
1068205310 10:53842544-53842566 GTTTTCTATTTAAGGAAACATGG - Intronic
1068461706 10:57337594-57337616 ATTCAATATTTGATGCAAAAAGG - Intergenic
1068581864 10:58750347-58750369 ATTTTAGATTTGATGAAATAGGG - Intronic
1072109358 10:92303592-92303614 ATTCATTATTTGATGCCACAAGG - Intronic
1073497498 10:103906652-103906674 ATTTTTTATTTTTTGAAACAAGG - Intronic
1073997379 10:109331377-109331399 ACTATCTATTGCATGAAACATGG + Intergenic
1074810738 10:117102760-117102782 ATTCTCTCAGTGATGAAAAAGGG + Intronic
1075293309 10:121249802-121249824 ATTTTATGTTTGATGAAATATGG - Intergenic
1075700438 10:124465895-124465917 TTTGTCAAATTGATGAAACAGGG - Intronic
1078968935 11:16383097-16383119 AGTCTCTATTTCATGACTCATGG - Intronic
1079699275 11:23522519-23522541 ATTCTCTATAAGAGGAAAAAAGG - Intergenic
1079922208 11:26447035-26447057 ATTTTCTTTTTGTAGAAACAGGG - Intronic
1081304341 11:41492786-41492808 ATTTTCTATTTTGTGAGACAGGG - Intergenic
1081366091 11:42237249-42237271 ATTCTGTATTTGTGGCAACATGG - Intergenic
1085673385 11:78490753-78490775 ATTCTTTTTTTTTTGAAACAGGG - Intronic
1085866560 11:80301666-80301688 ATTCTCTCTTTGAAGCAAAAAGG + Intergenic
1086431790 11:86743252-86743274 ATTATCTGTGTGAAGAAACATGG - Intergenic
1086862887 11:91946008-91946030 ATTCTCTTCTTAATGATACAAGG + Intergenic
1087636328 11:100705647-100705669 ATCCTCTTTTGAATGAAACATGG - Intronic
1087711246 11:101555178-101555200 AATCTCTTTTTGATGAAATCAGG + Intronic
1090996933 11:131875120-131875142 ATTCTATATGTGATGAAATAAGG - Intronic
1091081670 11:132675017-132675039 ATATTCTATTTAATGACACAGGG - Intronic
1091472024 12:737047-737069 ATTCTTTATTTGCTGAGGCATGG + Intergenic
1091531762 12:1363891-1363913 TTTCTCTATCTCCTGAAACAAGG - Intronic
1093113830 12:15185198-15185220 ATATTCTAGTTGTTGAAACATGG - Intronic
1093271832 12:17072426-17072448 TTTGTCTATGTGATGAAACCGGG + Intergenic
1093679976 12:21991113-21991135 ATTCTCCATTTAAAGCAACAGGG + Intergenic
1095771617 12:45965823-45965845 ATTCCCTATTTGGTTAAATAAGG + Intronic
1096656046 12:53092921-53092943 ATTCTTTTTTTTTTGAAACAGGG - Intergenic
1098075396 12:66724446-66724468 ATGATGTATTTGATGAAATAAGG - Intronic
1098575582 12:72038104-72038126 ATTCTCTATTTGGTGGTCCATGG - Intronic
1099364891 12:81756632-81756654 GTTCTCTCTTTCATGAAAGAGGG + Intronic
1100095997 12:91037848-91037870 GTTTTCTATTTAATGAAAAAAGG + Intergenic
1100778800 12:98001731-98001753 ATTATCTATTTGAAGACATAAGG + Intergenic
1101720760 12:107348716-107348738 TTTCTCTTTTTTATGAGACAGGG - Intronic
1102749821 12:115282769-115282791 AGTATCTATCTGATGATACATGG + Intergenic
1103096924 12:118139433-118139455 ATTCTCTGCATGAAGAAACACGG - Exonic
1103941388 12:124503153-124503175 ATTCTCTAATTGATGAGAATGGG - Intronic
1104408703 12:128540553-128540575 ATTCTCTGTTTTCTTAAACACGG + Intronic
1104411377 12:128560963-128560985 AGTCTCTATGTGCTGAAAGAAGG + Intronic
1104731955 12:131111803-131111825 ATTCTGTGTTTGATGAGACAGGG + Intronic
1107879385 13:44819811-44819833 ATTCTCTGTTAGATAAAAGAAGG - Intergenic
1107914938 13:45140043-45140065 TTTCTCTTTTTTTTGAAACAGGG + Intronic
1108506583 13:51117952-51117974 TTTTTCTATTGGCTGAAACAAGG - Intergenic
1108974756 13:56424847-56424869 TTTCCCTTTTTGATAAAACATGG - Intergenic
1109495664 13:63168505-63168527 CTTCTCTTTTTGTTTAAACAAGG - Intergenic
1109716026 13:66223509-66223531 ATTTTCCATTTGAGGAAACATGG - Intergenic
1109791735 13:67258044-67258066 ATTCTCTATTCCATAAAAAATGG - Intergenic
1110512695 13:76370043-76370065 TTTCTCTATTTGATGTGGCAAGG - Intergenic
1111080776 13:83304328-83304350 ATACTTTTTTTGAAGAAACATGG + Intergenic
1111576420 13:90160352-90160374 ATTCTGAATTTGAGGAAAAATGG - Intergenic
1111682751 13:91463885-91463907 ATTTTCCCTTTTATGAAACATGG - Intronic
1111708033 13:91775814-91775836 ATTCTCACTTAGATGAAACCTGG - Intronic
1112292188 13:98154663-98154685 ATTCTCTATGTGAATATACAGGG + Intronic
1112773201 13:102814410-102814432 ATTCTCTTTTTGTTGAATCTCGG - Intronic
1114151669 14:20047420-20047442 ATTCTTTATTTGCTAAGACATGG + Intergenic
1116818498 14:49604902-49604924 TTTTTCTTTTTGATGAGACAAGG + Intronic
1117045829 14:51812283-51812305 ATCCTCTCTTTGAGGAAAAATGG + Intergenic
1117762396 14:59043860-59043882 ATTTTAGATTTGATGAAATAAGG - Intergenic
1118091577 14:62486419-62486441 ATACTCAATTTGATGAACTATGG - Intergenic
1118244272 14:64093642-64093664 ATCATCTATTTTATGAAATAGGG - Intronic
1118608936 14:67524573-67524595 TTTCTCCATTTGAGGAAAGAAGG - Intronic
1119078218 14:71666048-71666070 ATTCTGTAGTTGTTGAAAAATGG - Intronic
1119250616 14:73150385-73150407 ATACTCAATTTTATTAAACATGG - Intronic
1119628750 14:76207307-76207329 ATTATCTATTTTTTGATACAGGG - Exonic
1120350324 14:83348454-83348476 ATCTTAGATTTGATGAAACATGG - Intergenic
1120579445 14:86227910-86227932 ATTCTCAATTTGATGTTACTTGG + Intergenic
1121050749 14:90817384-90817406 AATGGCTATTTGAAGAAACAGGG + Intergenic
1121057251 14:90867838-90867860 ATTCACAAATTCATGAAACAGGG + Exonic
1121491215 14:94362319-94362341 ATTCTCTTTATTCTGAAACAAGG - Intergenic
1124643640 15:31418276-31418298 ATTATCTATTTGAAGAAATTAGG + Intronic
1124781110 15:32634809-32634831 ATTCTCTAATGGATTAGACATGG - Intronic
1125229951 15:37442585-37442607 ATTCCTGATTTTATGAAACATGG + Intergenic
1126805088 15:52340119-52340141 AGTTTCTTTTTGATCAAACACGG - Intronic
1127067595 15:55256784-55256806 ATTTCATATTTGATAAAACAAGG - Intronic
1127104167 15:55595583-55595605 ATTTTCTATATTATGAAATATGG + Intergenic
1127758894 15:62118888-62118910 ATTAGCTAAGTGATGAAACAGGG + Intergenic
1128166078 15:65466143-65466165 TTTCTTTATTTGTTGAGACAAGG + Intronic
1129130655 15:73490686-73490708 ATTCTTTATTTTTTGAGACAAGG - Intronic
1129932253 15:79421661-79421683 AATCCATCTTTGATGAAACATGG + Intronic
1131218010 15:90555987-90556009 AATCTCTAGTTGATGAAAAATGG - Intronic
1131866499 15:96716899-96716921 CATCACTATTTGATGAAAAATGG + Intergenic
1131928463 15:97413037-97413059 ATTTTCAATTGAATGAAACATGG - Intergenic
1133401010 16:5487036-5487058 ATTCTCAAAGTGATGAAACAGGG - Intergenic
1134420651 16:14085142-14085164 ATTTTCTATCTGAAGAAAAAAGG - Intronic
1134747884 16:16602000-16602022 ATTCTTTTTTTGTTGAGACAGGG + Intergenic
1134997585 16:18751659-18751681 ATTCTTTTTTTGTTGAGACAGGG - Intergenic
1135781662 16:25308209-25308231 TTTCTTTGTTTGTTGAAACAGGG - Intergenic
1139062455 16:63269878-63269900 ATTCTATATTTTATTCAACAGGG - Intergenic
1140864473 16:79048128-79048150 ATTTTCTATTTCATGGAGCATGG + Intronic
1141293200 16:82740314-82740336 GTTCTCCATTTGGTGAAACTGGG + Intronic
1146701507 17:34964686-34964708 AGCTTCTATTTGATGAGACACGG + Intronic
1149808267 17:59639945-59639967 ATTCTTTATTTATTGAGACAGGG - Intronic
1149939068 17:60843670-60843692 ATTAGCTATTTAAAGAAACAAGG + Intronic
1150091362 17:62328580-62328602 ATTCTACATTTAAGGAAACAAGG + Intergenic
1150542886 17:66121848-66121870 ATTCTGTATTTGATGTGATATGG + Intronic
1151903766 17:77034831-77034853 ATTGTCCATTTAATGAAACGTGG + Intergenic
1152997364 18:420209-420231 GTTATCTATTGCATGAAACAAGG - Intronic
1153795205 18:8615447-8615469 ATTCTCTCTTAAGTGAAACACGG - Intronic
1155173128 18:23281901-23281923 AATCTGTATCTGATGAAAGAAGG + Intronic
1155744747 18:29340301-29340323 TTTCTCTACATGAGGAAACAAGG - Intergenic
1157163345 18:45335608-45335630 ATTCTCTATTTAAGAAGACATGG + Intronic
1158066810 18:53420399-53420421 CTTCTTTATTTCAGGAAACAGGG + Intronic
1159361726 18:67413794-67413816 AATTTCTATTTTATGGAACACGG + Intergenic
1161941618 19:7408268-7408290 TTTCTCTTTTTTTTGAAACAGGG - Intronic
1163273255 19:16266874-16266896 ATTCTCCATTTGATGTATCCCGG + Intergenic
1164544315 19:29146649-29146671 ATTCTCAATATGAGGAAATATGG + Intergenic
1167282514 19:48578204-48578226 TTTTTCTATTTGTTGAGACAGGG - Intronic
1167737044 19:51301145-51301167 ATTTTTTATTTTTTGAAACAGGG + Intergenic
925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG + Intronic
925932115 2:8716585-8716607 ATTCTCGATTTGATGGGAAAGGG + Intergenic
928875862 2:36038533-36038555 ATTCTCTATGTAAGGAAACCAGG - Intergenic
929490987 2:42395945-42395967 ATTCTTTTTTTTTTGAAACAAGG - Intronic
930126692 2:47803820-47803842 ATTCTCAATTTTATAACACAGGG - Intronic
930304515 2:49661629-49661651 ATTCTCTGTTGAATCAAACAGGG - Intergenic
930360681 2:50374635-50374657 ATTTTCTTTTTGATCAAATAAGG - Intronic
931151156 2:59574939-59574961 ATTCTCTACTTCATGTAACTTGG - Intergenic
931243481 2:60473336-60473358 ATTCTCTTTTTGAAGACCCAGGG - Intronic
931323255 2:61193421-61193443 ATTCTATCTTTGAAGAAAGAAGG - Intronic
931919348 2:66996224-66996246 ATGCACTATTTGTTGAACCATGG - Intergenic
931989208 2:67772611-67772633 ATTCACTATTGGCAGAAACATGG + Intergenic
932743697 2:74313553-74313575 ATTCTCTCCTGGATGTAACAGGG + Intronic
933612820 2:84455188-84455210 GTTTTATATTTGATGAAATATGG - Intronic
935042440 2:99446264-99446286 ATTTTGTATTTGAGGAGACAGGG - Intronic
936343566 2:111658390-111658412 ATTTTTTATTTTTTGAAACAGGG - Intergenic
936653628 2:114458307-114458329 ATTTCCTATTTTATGAAAAAGGG - Intronic
936790201 2:116142275-116142297 ATTCTCTAATTGACTAAACCAGG + Intergenic
937119981 2:119434333-119434355 ATTTTCTAGATGAGGAAACAAGG + Intronic
937484463 2:122300048-122300070 ATTTTCTCATTAATGAAACAGGG - Intergenic
938184310 2:129215130-129215152 ATTCTCTATTTAAAGGGACATGG - Intergenic
938309887 2:130282757-130282779 TATCTCTATATGATGAAACTTGG + Intergenic
938445030 2:131369612-131369634 TATCTCTATATGATGAAACTTGG - Intergenic
939104468 2:137933118-137933140 ATTTTCTCTTCTATGAAACAAGG - Intergenic
941263291 2:163324466-163324488 ATTTTTTCTTTTATGAAACATGG - Intergenic
941290661 2:163669386-163669408 ATTTTGTATTTGTTGAGACAGGG + Intronic
941591011 2:167420491-167420513 ATTGTGTATTTCAAGAAACAAGG + Intergenic
942695188 2:178634421-178634443 ATTCTCAATTTGATGATGAAGGG - Exonic
942767093 2:179469802-179469824 AGTCTCTCTTTGATTAAAAATGG + Intronic
942774848 2:179569095-179569117 ATTCTCTAGATGAGGAAACAGGG + Intronic
942903330 2:181149578-181149600 ACTGACTATTTGATGAAAGAGGG - Intergenic
943874953 2:193054795-193054817 ATTATATATTTGAAGAAAGAAGG + Intergenic
944510869 2:200464650-200464672 ATTATCAGTTTGATGAGACAGGG + Intronic
945153149 2:206810655-206810677 TTTTTATATTTGATGAAAAAGGG + Intergenic
945239771 2:207665802-207665824 ATTCTTTTTTTTTTGAAACAGGG + Intergenic
948031780 2:234823878-234823900 AGTCTACATTTGATGAAACATGG - Intergenic
948261930 2:236610648-236610670 ATTTTCTTTTTGATGTCACATGG + Intergenic
948971528 2:241431609-241431631 ATTCCCTATTTCATGAGAAAGGG + Intronic
1168877834 20:1183667-1183689 TGTCTCTATTTCATAAAACATGG + Intronic
1170021166 20:11838033-11838055 TGTCTCTATTTAATGAAACATGG + Intergenic
1170443108 20:16398498-16398520 TTTCTCTATCTGATGGCACAGGG - Intronic
1170666830 20:18393927-18393949 AATTTCTATTTGATTAAACCCGG + Intronic
1170777044 20:19384483-19384505 ATTCTTTGTTTGCTAAAACATGG - Intronic
1170933892 20:20793351-20793373 ATGCTCTATGGGATAAAACATGG - Intergenic
1172429637 20:34878689-34878711 ATTCTGTATTTGATGGAATTTGG - Intronic
1173795782 20:45858389-45858411 CTTATATATTTGTTGAAACAGGG + Intronic
1174234888 20:49081288-49081310 TTTCTTTATTTTTTGAAACAGGG + Intronic
1175595371 20:60227131-60227153 ATTTTCTTTTTTTTGAAACAGGG + Intergenic
1176175276 20:63719649-63719671 ATTCTCTATTTGGTTAGACATGG + Intronic
1177362751 21:20094624-20094646 AATCTCTACATGATGAAACATGG - Intergenic
1178035445 21:28577407-28577429 TTTGTCTTTTTCATGAAACATGG - Intergenic
1178075184 21:29009255-29009277 ATTTTTTATTTGTAGAAACAAGG + Intronic
1179013058 21:37571384-37571406 GTTCTGTATTTGGTGAGACATGG + Intergenic
1179371720 21:40811955-40811977 ATTCTCTTTTTGCTGAAGCAAGG - Intronic
1185357569 22:50383424-50383446 ATTCTGTATTTGGGAAAACACGG - Intronic
949259631 3:2090425-2090447 ATTCTGTATTTGAAGCAACATGG + Intergenic
949747274 3:7309723-7309745 ATTCTCCATTTGTGGAAAAAGGG + Intronic
950709148 3:14802698-14802720 ATTCTTCATTTGGAGAAACAGGG - Intergenic
951236792 3:20245556-20245578 ATTTTCTGTTTGATGACACTTGG - Intergenic
954252960 3:49382627-49382649 AATCTTTATTTGGTGAGACAGGG - Intronic
954989330 3:54826441-54826463 ATTTTCTACTTCATGAAACTTGG - Intronic
955121586 3:56065228-56065250 TTTCTTTATTTTATGAGACAGGG + Intronic
955315830 3:57938244-57938266 ATTCTATATTTTATCTAACAGGG - Intergenic
955830722 3:63000355-63000377 ATTCTGGTTTTGATGTAACAGGG + Intergenic
957619786 3:82580620-82580642 ATTCTTTATGTTTTGAAACAAGG + Intergenic
959437156 3:106330061-106330083 ATTTTATATATAATGAAACAGGG - Intergenic
959614414 3:108330944-108330966 ATTCACAATTTGAGGAAATATGG - Intronic
960135319 3:114098424-114098446 ATTTTATATTTGAGGAAACAGGG + Intergenic
960451915 3:117820545-117820567 ATTGTCTATTTAATGAGGCAAGG - Intergenic
961023743 3:123533153-123533175 ATTCTCTCTTTGATTGGACAGGG + Intronic
961161417 3:124730050-124730072 ATATTCTATTTGGAGAAACATGG + Intergenic
963009213 3:140753589-140753611 ATTCTCTATAGGATGTCACAGGG - Intergenic
963954702 3:151240946-151240968 ATTTGCTAATTGGTGAAACAGGG + Intronic
964201839 3:154126226-154126248 ATTCTGTAGTTGATGAGAAAAGG + Intronic
965686003 3:171303498-171303520 TTTCTGTATTTAGTGAAACAAGG - Intronic
966602577 3:181789985-181790007 ATTTTCTTTTTGTAGAAACAGGG + Intergenic
966703207 3:182879249-182879271 TTTCTCTTTTTTGTGAAACAGGG - Intronic
968327356 3:197830252-197830274 AATCTCTTTTTTTTGAAACAAGG + Intronic
969233691 4:5850221-5850243 CTTCCCTATTTGCTGAAATAGGG - Intronic
969547190 4:7838005-7838027 TTTCTTTGTTTGTTGAAACAAGG - Intronic
970695267 4:18669462-18669484 ATTTTGTATTTTATGAAAAATGG + Intergenic
971110931 4:23585166-23585188 ATTTTCTCTTGGATGAAACAAGG + Intergenic
971145530 4:23971961-23971983 ATTATGTATTTGATTAAAAATGG - Intergenic
971341731 4:25775695-25775717 GTTCTTTATGGGATGAAACATGG - Intronic
971662029 4:29431003-29431025 ACTATTTGTTTGATGAAACAAGG + Intergenic
971797031 4:31241639-31241661 ATTCTTTATTTGATGGAAAAAGG + Intergenic
972717913 4:41666840-41666862 ATTCTCTATTTGAGCAGACCAGG + Intronic
973044354 4:45517867-45517889 ATTTTCTATTTGAAGTAGCATGG - Intergenic
973148119 4:46855332-46855354 ATTATTTATTTGATTAAAAAAGG + Intronic
973676607 4:53269627-53269649 ATTCTCTATTTGTTTAAAAAAGG - Intronic
973967389 4:56177715-56177737 ATTCTCTATTTGTTCAATCTTGG + Intronic
975655595 4:76638379-76638401 ATTTTTTTTTTGTTGAAACAGGG - Intronic
976405911 4:84660064-84660086 ATTCTTTATTTTTTGAGACAGGG - Intergenic
976425641 4:84900040-84900062 CTTCTTTATTTTTTGAAACAGGG - Intronic
976489808 4:85657058-85657080 ATTTTCTATTGACTGAAACAAGG + Intronic
976869256 4:89770837-89770859 CTTATTTCTTTGATGAAACAAGG - Intronic
977422454 4:96819185-96819207 ATTCTCTAAGTGGTGAAACCAGG + Intergenic
978577911 4:110204143-110204165 ATTTTCTTTTTGTAGAAACAGGG - Intergenic
979578652 4:122328157-122328179 CTTCACTATTTGATGAATAATGG - Exonic
980267234 4:130533019-130533041 ATTTAGAATTTGATGAAACACGG + Intergenic
981088457 4:140708115-140708137 ATTCTCAATTTGATGAACATTGG + Intronic
981539179 4:145831244-145831266 ATTCTGTATTTGACCATACAAGG + Intronic
981847992 4:149191774-149191796 ATTCACTATTTTATGACACCAGG - Intergenic
982795502 4:159638942-159638964 ATTCTCTGTCTTCTGAAACATGG + Intergenic
983182591 4:164666551-164666573 ATTATTTTTTTTATGAAACAGGG - Intergenic
983328996 4:166300089-166300111 GCTCTCTATATGATGAAATAAGG + Intergenic
983801369 4:171934338-171934360 ATTCTCTTTTTGGTAAAACCAGG + Intronic
985010627 4:185578968-185578990 ATTTTTTATTTTATGAGACAGGG + Intergenic
985042073 4:185900993-185901015 AATCTCAATTGCATGAAACAAGG + Intronic
986484109 5:8217967-8217989 ATTTCCTCATTGATGAAACAAGG + Intergenic
986487858 5:8258252-8258274 ATTCTGTATGTGATGGAGCATGG + Intergenic
987784332 5:22479654-22479676 ATTATCTATTTGTTGGAAAATGG + Intronic
987969163 5:24919932-24919954 ATTCTCTTTTTGATGACATTAGG - Intergenic
991035960 5:62127717-62127739 ATACTCTAATTGTTGAAAAAAGG + Intergenic
991311903 5:65252898-65252920 ATTTTTTATTTGTTGAGACAGGG + Intronic
992485149 5:77187606-77187628 ATTTTAGATTTGATGAAATATGG + Intergenic
993039567 5:82797508-82797530 ATTCATTTTTTGAAGAAACAGGG - Intergenic
993270058 5:85785448-85785470 ATTCTCTAATGGAAGAAATAGGG + Intergenic
993640926 5:90404386-90404408 ATTGTTTATTTGTAGAAACAAGG - Intronic
994065553 5:95536227-95536249 ATGCTCTATTTCATTAAAAAAGG + Intronic
994509600 5:100687465-100687487 ATTATCTATTTTATGAAATCTGG + Intergenic
994704616 5:103186603-103186625 ATTAACTGTCTGATGAAACATGG - Intronic
994918942 5:106017062-106017084 ATAGTCTACTTGGTGAAACATGG + Intergenic
995151304 5:108849834-108849856 ATTCTCTCTGTCATGAATCAAGG - Intronic
995726224 5:115182972-115182994 TTTCTCCATTTGATGAAAGTTGG - Intergenic
998575533 5:143311571-143311593 ATTCACTATTTCATAACACATGG + Intronic
999725936 5:154437777-154437799 ATTCTTTTTTTTATGAGACAGGG - Intergenic
1002484661 5:179526234-179526256 AATCTCAAAATGATGAAACACGG + Intergenic
1002968415 6:1990582-1990604 ATTCTTTTTTTGTTGAGACAGGG + Intronic
1004575965 6:16895128-16895150 ATTTTCTATATGATGTAAAAAGG - Intergenic
1005196125 6:23286398-23286420 ATGCTGGATTTGAGGAAACAAGG - Intergenic
1005853839 6:29845088-29845110 AATCTCTCTTTGATGAATAAAGG - Intergenic
1006963742 6:37961065-37961087 ATTTACTATTTTTTGAAACAGGG - Intronic
1011670757 6:89680847-89680869 GTTCTCTATTTGCTGAACTAGGG - Intronic
1011721618 6:90162634-90162656 ATTTTTTATTTTTTGAAACAGGG - Intronic
1012126990 6:95442362-95442384 ATTATCTCTTTGAGGAAAGAGGG - Intergenic
1012244103 6:96907001-96907023 ATTATCTTTTTGATGAAAATGGG - Intergenic
1012580342 6:100861263-100861285 ATTTTGTATGTGAAGAAACAGGG - Intronic
1014193798 6:118528591-118528613 ATTAACTATTTTATGAATCAGGG - Intronic
1014207239 6:118669465-118669487 ATTCTTTGTTAGATGAAGCATGG + Intronic
1015343184 6:132126033-132126055 ATTCTCTATTACATGAATGATGG - Intergenic
1015481145 6:133711247-133711269 AATGGCTATTTGATGAAATAAGG - Intergenic
1015665276 6:135621215-135621237 ATACTTTATTTCATTAAACATGG - Intergenic
1015825830 6:137310646-137310668 ATTTTCTACTAGTTGAAACAGGG + Intergenic
1015972437 6:138756089-138756111 ATGCTCTATTTTATGTAATAAGG + Intronic
1016571556 6:145519277-145519299 CTTCTCTATTTGATGCACCATGG + Intronic
1017267576 6:152467384-152467406 ATTCATTATTTGATCAAAAATGG + Intronic
1017993962 6:159514833-159514855 ATCCCTTATTTTATGAAACAAGG + Intergenic
1018194118 6:161339613-161339635 ATTTTCTTTTTTATGAGACAGGG - Intergenic
1020926236 7:14329477-14329499 ATTCTCTATCTGGAGGAACAAGG + Intronic
1021534437 7:21687617-21687639 TTTATCTATTTCATGAGACAGGG - Intronic
1021661221 7:22919559-22919581 ACTCTCTACTTGATGGGACATGG - Intergenic
1022246502 7:28565166-28565188 ATTCTCTCATTTATGATACATGG - Intronic
1022761806 7:33363815-33363837 CTTCTTTATTTGATTAAATATGG + Intronic
1023761048 7:43465570-43465592 ATGTTCTATTGGTTGAAACAAGG + Intronic
1024841954 7:53596963-53596985 AATCTCTCTTTGATGAAAAAAGG - Intergenic
1026201270 7:68216612-68216634 ATACTCTTTTTTTTGAAACAGGG + Intergenic
1026671291 7:72392824-72392846 ATTTTTTTTTTAATGAAACAGGG - Intronic
1028171451 7:87601369-87601391 ATCCTTTATTTGATGATAAATGG + Intronic
1028394084 7:90348209-90348231 ATTTTCTTTTTTTTGAAACAGGG - Intronic
1028591869 7:92505483-92505505 ATTCTCAATGGGATGAAACTGGG - Intronic
1028867299 7:95728477-95728499 ATTCACTATTTCATTAAAAAAGG + Intergenic
1031023155 7:116650229-116650251 ATTCTGTATTTGTTGCCACAGGG + Intergenic
1031202669 7:118709436-118709458 CTTCTCTATTTTATTAAACATGG - Intergenic
1031606915 7:123780358-123780380 GTTCCCTATTTAATAAAACAGGG + Intergenic
1031621631 7:123940663-123940685 ATTTTCTATTTTTTTAAACATGG + Intronic
1031866940 7:127047827-127047849 ATTTTTTATTTTTTGAAACAGGG - Intronic
1031910863 7:127515541-127515563 ATGCTGCATTTGATGAAATAGGG - Intergenic
1032533454 7:132640713-132640735 GTCCTGGATTTGATGAAACATGG - Intronic
1032681572 7:134190211-134190233 ATTATTTATTTATTGAAACAGGG + Intronic
1033006063 7:137564725-137564747 ATATTATACTTGATGAAACAGGG - Intronic
1033539251 7:142340601-142340623 ATTTTCTATTTGACGACATAGGG - Intergenic
1034702679 7:153110053-153110075 AGTCATTATTTCATGAAACAAGG - Intergenic
1035722555 8:1802924-1802946 ATTGTGTATTTGGTGAAAGAAGG + Intergenic
1037314323 8:17586382-17586404 ATTCTTTGTTTGATGTGACATGG - Intronic
1038116249 8:24559078-24559100 ATTTTTTATATGATGAAAGAAGG - Intergenic
1038265193 8:26033828-26033850 ATTTTTTATTTTATAAAACATGG - Intronic
1039502326 8:38027913-38027935 ACTCTCTCTTTTTTGAAACAAGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041560115 8:59208165-59208187 ATTAACCATTTGATGAAACAGGG + Intergenic
1041874342 8:62670485-62670507 ATTCTCTATTTGGGGAGGCAGGG + Intronic
1042448573 8:68918532-68918554 AGTCTCTGTTTGAAGAGACATGG + Intergenic
1042449218 8:68924753-68924775 ACACTCTATTAAATGAAACAAGG - Intergenic
1042561384 8:70074289-70074311 ATTCGGTATTAGATGAAGCATGG - Intergenic
1043122426 8:76344133-76344155 ATTCTCTCTTTATAGAAACATGG + Intergenic
1043285397 8:78522146-78522168 ATTGTCTATTACATTAAACATGG + Intronic
1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG + Intergenic
1044648697 8:94471803-94471825 ATTTTAGATTTGATGAAATATGG - Intronic
1045568956 8:103350324-103350346 ATTTTTTATTTTAAGAAACAAGG - Intergenic
1045850329 8:106688308-106688330 ATTCTCTTTAAGATAAAACATGG + Intronic
1046601672 8:116324432-116324454 ATTTTCCATTTGGAGAAACAGGG + Intergenic
1047048926 8:121087515-121087537 AATCTCTATTTGCTAAAACTTGG + Intergenic
1047113252 8:121814327-121814349 ATTCTCACTTTGAGTAAACAGGG + Intergenic
1047162241 8:122393423-122393445 ATTCTCTGTTTAATGAAACATGG + Intergenic
1047833461 8:128661287-128661309 ATTTTTTATTTGATTAAACTTGG - Intergenic
1048679252 8:136821444-136821466 AGTATCTATTTTATGAAACTAGG + Intergenic
1048903472 8:139063289-139063311 ATTCTCTACTGCATGACACATGG + Intergenic
1048974677 8:139664531-139664553 ATTCTCAATTCGGTGAAACTAGG - Intronic
1049080179 8:140436763-140436785 ATTCTCTAATTGATACAATAAGG + Intronic
1049445180 8:142626904-142626926 ATTCCCTATTACAGGAAACAAGG - Intergenic
1051113311 9:13665039-13665061 ATTCCCTATTTAATGAAAACTGG + Intergenic
1051349519 9:16185726-16185748 ATTTTCCATTTTTTGAAACAGGG + Intergenic
1051460360 9:17306450-17306472 GTGCTCTATTTTATGAAGCAAGG + Intronic
1051533230 9:18128647-18128669 ATTCTCTATTTCATTAGAGACGG - Intergenic
1051934205 9:22424830-22424852 ATACTATATTTGCTGACACATGG + Intergenic
1053679763 9:40477669-40477691 ACTCTCCATGTGATGAAAGAAGG - Intergenic
1054323037 9:63692067-63692089 ATTCCTAGTTTGATGAAACATGG - Intergenic
1054504859 9:65898629-65898651 ACTCTCCATGTGATGAAAGAAGG + Intergenic
1055077870 9:72235706-72235728 ATTCTCTTTTTTCTGAGACAAGG - Intronic
1055753973 9:79537436-79537458 ATTATATATTTAAAGAAACATGG + Intergenic
1056179444 9:84067407-84067429 ACTGTCTAATTGAAGAAACAAGG - Intergenic
1056202735 9:84291979-84292001 TTTCTCCATGTGATGGAACAGGG + Intronic
1056364172 9:85886305-85886327 ATTCTCTAGTAGAAGAAACCAGG - Intergenic
1056770232 9:89473079-89473101 ATACTTTATTTGTTGAGACAGGG - Intronic
1057223490 9:93270826-93270848 ATTCTTTATTTGAGGAAGCCAGG + Intronic
1057271690 9:93655218-93655240 ATTGGCTATTTGATGATACCAGG - Intronic
1057558262 9:96106563-96106585 ATTCTCTATTTGATGGAACATGG + Intergenic
1057575298 9:96237618-96237640 ATTTACCATTTGATGATACATGG + Intronic
1058224867 9:102347421-102347443 ATAAACTATTTGATGAAGCAAGG - Intergenic
1059082995 9:111269680-111269702 ATCCTATATTTGTAGAAACATGG - Intergenic
1059477390 9:114558464-114558486 CTGCTCTATTTGATCACACACGG + Intergenic
1059775008 9:117465596-117465618 TTTCTCTTTTTGGTGAAGCAGGG + Intergenic
1059899051 9:118902010-118902032 TTTCTCTATTTGCAGAAACTCGG - Intergenic
1059943951 9:119386762-119386784 ATTTTATATTTGAGGAAAAATGG + Intergenic
1060590263 9:124811840-124811862 CTTTTCTCTTTCATGAAACAGGG - Exonic
1060672119 9:125479061-125479083 ATTTTTTATATGATGAAACTGGG - Intronic
1062219745 9:135408835-135408857 ATTCTCCATCTGAGGAAACTGGG + Intergenic
1185431062 X:12339-12361 CTTCTCTAGTTTATGAAACAGGG + Intergenic
1185440328 X:224736-224758 CTTCTCTAGTTTATGAAACAGGG + Intergenic
1187712031 X:22063980-22064002 ATTTTTGATTTGATGAAATATGG - Intronic
1188004572 X:25008183-25008205 ATCCTCTATGAAATGAAACAGGG + Intronic
1189849957 X:45168346-45168368 ATTCACTCTTTGATGATCCAAGG - Intronic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1192960077 X:76120797-76120819 ATTCTCTATTTAGTGAGACATGG - Intergenic
1194970966 X:100343546-100343568 ATTCTCCATTTCATGAGAAATGG - Intronic
1195316968 X:103688383-103688405 ATTAACTCTTTGATTAAACAAGG - Intergenic
1197448078 X:126577312-126577334 ATTCTCTAGTTGTTGAAAAAAGG - Intergenic
1197460850 X:126738842-126738864 TTTCTCTATTTATTGAACCAAGG + Intergenic
1198100653 X:133419145-133419167 CTTCTCTCTTTCCTGAAACACGG - Intergenic
1198405622 X:136309695-136309717 AATCTCTATTATAAGAAACATGG - Intronic
1200665604 Y:6018338-6018360 ATTCTGTGTTTTGTGAAACATGG - Intergenic