ID: 1064757679

View in Genome Browser
Species Human (GRCh38)
Location 10:18586695-18586717
Sequence TCTTGCTGCCGCTGACTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3501
Summary {0: 1, 1: 20, 2: 1155, 3: 1453, 4: 872}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064757679_1064757682 23 Left 1064757679 10:18586695-18586717 CCAAAGAGTCAGCGGCAGCAAGA 0: 1
1: 20
2: 1155
3: 1453
4: 872
Right 1064757682 10:18586741-18586763 AAAGTTTCCACTATGTGGAAGGG No data
1064757679_1064757680 18 Left 1064757679 10:18586695-18586717 CCAAAGAGTCAGCGGCAGCAAGA 0: 1
1: 20
2: 1155
3: 1453
4: 872
Right 1064757680 10:18586736-18586758 AGAACAAAGTTTCCACTATGTGG No data
1064757679_1064757681 22 Left 1064757679 10:18586695-18586717 CCAAAGAGTCAGCGGCAGCAAGA 0: 1
1: 20
2: 1155
3: 1453
4: 872
Right 1064757681 10:18586740-18586762 CAAAGTTTCCACTATGTGGAAGG No data
1064757679_1064757683 24 Left 1064757679 10:18586695-18586717 CCAAAGAGTCAGCGGCAGCAAGA 0: 1
1: 20
2: 1155
3: 1453
4: 872
Right 1064757683 10:18586742-18586764 AAGTTTCCACTATGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064757679 Original CRISPR TCTTGCTGCCGCTGACTCTT TGG (reversed) Intronic
Too many off-targets to display for this crispr