ID: 1064757681

View in Genome Browser
Species Human (GRCh38)
Location 10:18586740-18586762
Sequence CAAAGTTTCCACTATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064757678_1064757681 23 Left 1064757678 10:18586694-18586716 CCCAAAGAGTCAGCGGCAGCAAG 0: 1
1: 21
2: 1169
3: 1493
4: 819
Right 1064757681 10:18586740-18586762 CAAAGTTTCCACTATGTGGAAGG No data
1064757679_1064757681 22 Left 1064757679 10:18586695-18586717 CCAAAGAGTCAGCGGCAGCAAGA 0: 1
1: 20
2: 1155
3: 1453
4: 872
Right 1064757681 10:18586740-18586762 CAAAGTTTCCACTATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064757681 Original CRISPR CAAAGTTTCCACTATGTGGA AGG Intronic
No off target data available for this crispr