ID: 1064764748

View in Genome Browser
Species Human (GRCh38)
Location 10:18659518-18659540
Sequence CGCCTGAGATCGCGCAGCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 27}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064764748_1064764762 23 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151
1064764748_1064764754 11 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764754 10:18659552-18659574 GCTCCGCGCAGCCCGCGCCGCGG 0: 1
1: 0
2: 5
3: 14
4: 206
1064764748_1064764757 15 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764757 10:18659556-18659578 CGCGCAGCCCGCGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 144
1064764748_1064764758 16 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764758 10:18659557-18659579 GCGCAGCCCGCGCCGCGGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 160
1064764748_1064764759 17 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764759 10:18659558-18659580 CGCAGCCCGCGCCGCGGTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 171
1064764748_1064764756 14 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764756 10:18659555-18659577 CCGCGCAGCCCGCGCCGCGGTGG 0: 1
1: 0
2: 2
3: 36
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064764748 Original CRISPR CGCCTGAGATCGCGCAGCGA GGG (reversed) Exonic