ID: 1064764749

View in Genome Browser
Species Human (GRCh38)
Location 10:18659519-18659541
Sequence CCGCCTGAGATCGCGCAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064764749_1064764757 14 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764757 10:18659556-18659578 CGCGCAGCCCGCGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 144
1064764749_1064764759 16 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764759 10:18659558-18659580 CGCAGCCCGCGCCGCGGTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 171
1064764749_1064764756 13 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764756 10:18659555-18659577 CCGCGCAGCCCGCGCCGCGGTGG 0: 1
1: 0
2: 2
3: 36
4: 277
1064764749_1064764754 10 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764754 10:18659552-18659574 GCTCCGCGCAGCCCGCGCCGCGG 0: 1
1: 0
2: 5
3: 14
4: 206
1064764749_1064764762 22 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151
1064764749_1064764758 15 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764758 10:18659557-18659579 GCGCAGCCCGCGCCGCGGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 160
1064764749_1064764764 30 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764764 10:18659572-18659594 CGGTGGGGGACCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 22
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064764749 Original CRISPR CCGCCTGAGATCGCGCAGCG AGG (reversed) Exonic